ID: 923035985

View in Genome Browser
Species Human (GRCh38)
Location 1:230285436-230285458
Sequence GGTGGGAGGTGACTGCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035985_923035999 22 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035999 1:230285481-230285503 GTTTTGCTGGCAAGGAGGACAGG No data
923035985_923035996 9 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035996 1:230285468-230285490 GTCATGGAAGTGGGTTTTGCTGG No data
923035985_923035997 14 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data
923035985_923036002 28 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923036002 1:230285487-230285509 CTGGCAAGGAGGACAGGGAAGGG No data
923035985_923035987 -7 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data
923035985_923035998 17 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035998 1:230285476-230285498 AGTGGGTTTTGCTGGCAAGGAGG No data
923035985_923036000 23 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923036000 1:230285482-230285504 TTTTGCTGGCAAGGAGGACAGGG No data
923035985_923035991 -1 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data
923035985_923035992 0 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035992 1:230285459-230285481 TCCTCCCATGTCATGGAAGTGGG No data
923035985_923036001 27 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923036001 1:230285486-230285508 GCTGGCAAGGAGGACAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035985 Original CRISPR GGTGGGAGGTGACTGCTTCC CGG (reversed) Intergenic
No off target data available for this crispr