ID: 923035987

View in Genome Browser
Species Human (GRCh38)
Location 1:230285452-230285474
Sequence TCCCACCTCCTCCCATGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035973_923035987 30 Left 923035973 1:230285399-230285421 CCCGGGTCGCACTGCCCAGAGCC No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data
923035979_923035987 16 Left 923035979 1:230285413-230285435 CCCAGAGCCGGGTCCTTGGGAAG No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data
923035983_923035987 9 Left 923035983 1:230285420-230285442 CCGGGTCCTTGGGAAGCCGGGAA No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data
923035985_923035987 -7 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data
923035980_923035987 15 Left 923035980 1:230285414-230285436 CCAGAGCCGGGTCCTTGGGAAGC No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data
923035984_923035987 3 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data
923035974_923035987 29 Left 923035974 1:230285400-230285422 CCGGGTCGCACTGCCCAGAGCCG No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035987 Original CRISPR TCCCACCTCCTCCCATGTCA TGG Intergenic
No off target data available for this crispr