ID: 923035991

View in Genome Browser
Species Human (GRCh38)
Location 1:230285458-230285480
Sequence CTCCTCCCATGTCATGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035983_923035991 15 Left 923035983 1:230285420-230285442 CCGGGTCCTTGGGAAGCCGGGAA No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data
923035985_923035991 -1 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data
923035980_923035991 21 Left 923035980 1:230285414-230285436 CCAGAGCCGGGTCCTTGGGAAGC No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data
923035984_923035991 9 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data
923035979_923035991 22 Left 923035979 1:230285413-230285435 CCCAGAGCCGGGTCCTTGGGAAG No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035991 Original CRISPR CTCCTCCCATGTCATGGAAG TGG Intergenic