ID: 923035996

View in Genome Browser
Species Human (GRCh38)
Location 1:230285468-230285490
Sequence GTCATGGAAGTGGGTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035986_923035996 -5 Left 923035986 1:230285450-230285472 CCTCCCACCTCCTCCCATGTCAT No data
Right 923035996 1:230285468-230285490 GTCATGGAAGTGGGTTTTGCTGG No data
923035983_923035996 25 Left 923035983 1:230285420-230285442 CCGGGTCCTTGGGAAGCCGGGAA No data
Right 923035996 1:230285468-230285490 GTCATGGAAGTGGGTTTTGCTGG No data
923035989_923035996 -9 Left 923035989 1:230285454-230285476 CCACCTCCTCCCATGTCATGGAA No data
Right 923035996 1:230285468-230285490 GTCATGGAAGTGGGTTTTGCTGG No data
923035984_923035996 19 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035996 1:230285468-230285490 GTCATGGAAGTGGGTTTTGCTGG No data
923035985_923035996 9 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035996 1:230285468-230285490 GTCATGGAAGTGGGTTTTGCTGG No data
923035988_923035996 -8 Left 923035988 1:230285453-230285475 CCCACCTCCTCCCATGTCATGGA No data
Right 923035996 1:230285468-230285490 GTCATGGAAGTGGGTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035996 Original CRISPR GTCATGGAAGTGGGTTTTGC TGG Intergenic