ID: 923035997

View in Genome Browser
Species Human (GRCh38)
Location 1:230285473-230285495
Sequence GGAAGTGGGTTTTGCTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035988_923035997 -3 Left 923035988 1:230285453-230285475 CCCACCTCCTCCCATGTCATGGA No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data
923035993_923035997 -10 Left 923035993 1:230285460-230285482 CCTCCCATGTCATGGAAGTGGGT No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data
923035985_923035997 14 Left 923035985 1:230285436-230285458 CCGGGAAGCAGTCACCTCCCACC No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data
923035989_923035997 -4 Left 923035989 1:230285454-230285476 CCACCTCCTCCCATGTCATGGAA No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data
923035986_923035997 0 Left 923035986 1:230285450-230285472 CCTCCCACCTCCTCCCATGTCAT No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data
923035984_923035997 24 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data
923035983_923035997 30 Left 923035983 1:230285420-230285442 CCGGGTCCTTGGGAAGCCGGGAA No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data
923035990_923035997 -7 Left 923035990 1:230285457-230285479 CCTCCTCCCATGTCATGGAAGTG No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035997 Original CRISPR GGAAGTGGGTTTTGCTGGCA AGG Intergenic