ID: 923040394

View in Genome Browser
Species Human (GRCh38)
Location 1:230315557-230315579
Sequence AAACACATGGGCCAGTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923040394_923040401 -8 Left 923040394 1:230315557-230315579 CCCCTAAACTGGCCCATGTGTTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 923040401 1:230315572-230315594 ATGTGTTTAGTTGTAGAATGGGG 0: 1
1: 0
2: 1
3: 21
4: 318
923040394_923040405 11 Left 923040394 1:230315557-230315579 CCCCTAAACTGGCCCATGTGTTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 923040405 1:230315591-230315613 GGGGGCCAGGACTGGACATGTGG 0: 1
1: 0
2: 0
3: 29
4: 314
923040394_923040403 -2 Left 923040394 1:230315557-230315579 CCCCTAAACTGGCCCATGTGTTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 923040403 1:230315578-230315600 TTAGTTGTAGAATGGGGGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 159
923040394_923040404 3 Left 923040394 1:230315557-230315579 CCCCTAAACTGGCCCATGTGTTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 923040404 1:230315583-230315605 TGTAGAATGGGGGCCAGGACTGG 0: 1
1: 0
2: 7
3: 44
4: 304
923040394_923040400 -9 Left 923040394 1:230315557-230315579 CCCCTAAACTGGCCCATGTGTTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 923040400 1:230315571-230315593 CATGTGTTTAGTTGTAGAATGGG 0: 1
1: 0
2: 1
3: 15
4: 200
923040394_923040402 -7 Left 923040394 1:230315557-230315579 CCCCTAAACTGGCCCATGTGTTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 923040402 1:230315573-230315595 TGTGTTTAGTTGTAGAATGGGGG 0: 1
1: 0
2: 1
3: 17
4: 219
923040394_923040399 -10 Left 923040394 1:230315557-230315579 CCCCTAAACTGGCCCATGTGTTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 923040399 1:230315570-230315592 CCATGTGTTTAGTTGTAGAATGG 0: 1
1: 0
2: 0
3: 6
4: 150
923040394_923040407 25 Left 923040394 1:230315557-230315579 CCCCTAAACTGGCCCATGTGTTT 0: 1
1: 0
2: 0
3: 13
4: 166
Right 923040407 1:230315605-230315627 GACATGTGGTTTGATTGCTAAGG 0: 1
1: 0
2: 1
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923040394 Original CRISPR AAACACATGGGCCAGTTTAG GGG (reversed) Intergenic
907671834 1:56481298-56481320 AAACAGATGGCCCAGTGTGGGGG - Intergenic
907713732 1:56908426-56908448 AATCACATGGGCTAAATTAGGGG + Intronic
907941368 1:59090994-59091016 AGACAGATGAGCTAGTTTAGGGG + Intergenic
911424385 1:97687957-97687979 ACACACTGGGGCCAGTTGAGTGG + Intronic
913378096 1:118177301-118177323 AAGCATATGAGCCAGTTCAGGGG + Intronic
915392315 1:155555207-155555229 AAACACACAGGCCAGTGCAGTGG + Intronic
916222835 1:162461702-162461724 ATACACATGTGCCAGTTTCTTGG - Intergenic
918777019 1:188645674-188645696 AAACACATGGGGAAATTGAGAGG - Intergenic
919262379 1:195213517-195213539 AAACACCTGGGTCAGGTTAAGGG + Intergenic
919416020 1:197310789-197310811 AATTACATAGGGCAGTTTAGGGG + Intronic
921005867 1:211093295-211093317 AAACAAATGGACCTGTTAAGAGG - Intronic
922204524 1:223434989-223435011 AAACACAGGGGCTAGGTTGGAGG + Intergenic
923040394 1:230315557-230315579 AAACACATGGGCCAGTTTAGGGG - Intergenic
923270110 1:232347835-232347857 AAACACATGGTGCAGTTGAAGGG + Intergenic
923335804 1:232969138-232969160 AACCACATGAGCAAGCTTAGAGG - Intronic
923649475 1:235860300-235860322 TAACAAATGTACCAGTTTAGGGG - Intronic
1068639841 10:59391192-59391214 ATAAACCTTGGCCAGTTTAGAGG - Intergenic
1071003426 10:80856288-80856310 ATACTCATGGGCCAGCTAAGAGG + Intergenic
1071126286 10:82339194-82339216 AAACAAATGTGACATTTTAGGGG + Intronic
1071206847 10:83289945-83289967 AAAAAAATGGGCCAGCTTTGTGG + Intergenic
1073316401 10:102583945-102583967 AAACAGATGGGCCAGTTCCCTGG - Intronic
1073348608 10:102802781-102802803 AAACACAGGGCCCAGTGTGGTGG - Intronic
1075193829 10:120336982-120337004 AAAAACATGGGCAAGTTCATTGG + Intergenic
1080164258 11:29217985-29218007 AAGCACATGGGGCAGTGTACAGG + Intergenic
1080555331 11:33410976-33410998 CCACACAAGGACCAGTTTAGGGG + Intergenic
1081122080 11:39279210-39279232 AAAAACATGGGCAAGTTTAAAGG + Intergenic
1082933796 11:58636146-58636168 AAACAGATCGGCAAGGTTAGGGG - Intergenic
1082962810 11:58934967-58934989 ATCCACAGGGGCCAGATTAGGGG + Intronic
1083315035 11:61809598-61809620 AAAGACATGGGCAGGTTAAGTGG - Intronic
1083402239 11:62431584-62431606 AAATACATGCCCCAGATTAGGGG - Intergenic
1084437646 11:69153693-69153715 AAACACATGGAAGAGTTCAGAGG + Intergenic
1087982503 11:104633589-104633611 ACACCCATGGGCCCTTTTAGGGG + Intergenic
1089853533 11:121520402-121520424 AAACACATGGAGCAGATGAGTGG + Intronic
1094047244 12:26180554-26180576 AAGCACAGGGGACAGTTAAGGGG - Intronic
1094126955 12:27033331-27033353 AAACTCTTGGGCCTCTTTAGAGG + Intronic
1094486710 12:30930943-30930965 AAGCACATGGCCCTGCTTAGAGG + Intronic
1096687226 12:53296202-53296224 AAACACCTGGGGAAGGTTAGCGG - Intronic
1096746485 12:53731154-53731176 AAACACATGATCCTGATTAGTGG - Intergenic
1098438179 12:70490972-70490994 ACACACCTGGGCCTGTTCAGGGG - Intergenic
1102205290 12:111086184-111086206 AAAGACATTGGCCACTTCAGTGG + Intronic
1102744812 12:115241455-115241477 AGACACATTAGCAAGTTTAGAGG + Intergenic
1103086759 12:118067451-118067473 AAAAAAAAAGGCCAGTTTAGGGG - Intronic
1113338403 13:109398927-109398949 ACACACCTGGGCCTGTTGAGGGG + Intergenic
1118416491 14:65542507-65542529 TAACACATAGGCCAGATTAGTGG - Intronic
1118607296 14:67513907-67513929 AAACAAATGGGCCAGGTTCCAGG - Intronic
1121614853 14:95306808-95306830 AAACATATGGGGAAGTTGAGAGG + Intronic
1123452675 15:20380695-20380717 ACACACATGCACCAGTTAAGAGG - Intergenic
1124159167 15:27253431-27253453 AGACAAATGGGCCAGCTGAGTGG - Intronic
1125630665 15:41144432-41144454 AAACACCTGGGCCAGTGCGGTGG + Intergenic
1127755288 15:62086112-62086134 AAACAAAGAGGCCAGTTAAGAGG + Intergenic
1128293631 15:66498137-66498159 AAACACATGTGCAAGTTTTGTGG - Exonic
1130627609 15:85531914-85531936 AAACACATTGCCCTGTTTATAGG + Intronic
1131284670 15:91047501-91047523 AAACACATGGGACATTTTTAGGG + Intergenic
1132193419 15:99890098-99890120 AAACATATGGTCCAGTGTAGTGG - Intergenic
1133180646 16:4051587-4051609 GAACACAGGGGCCAGCTTGGAGG + Intronic
1138975992 16:62208607-62208629 GAACACAGGGGCCTGTTGAGGGG - Intergenic
1141388850 16:83647688-83647710 AAAAAGATGGGCCATTTGAGGGG - Intronic
1144814615 17:18025343-18025365 ACAGACATGAGCCAGTTGAGAGG + Intronic
1145748226 17:27336337-27336359 AGAGACATGGGCCAGGTTAAGGG + Intergenic
1147117198 17:38309744-38309766 ACACACATGGCCCAGTGTGGTGG - Intronic
1147423670 17:40334964-40334986 AGCCCCAGGGGCCAGTTTAGGGG - Intronic
1148412484 17:47479860-47479882 ACACACATGGCCCAGTGTGGTGG + Intergenic
1152289280 17:79429629-79429651 TCACACCTGGGCCAGTTGAGAGG + Intronic
1152778003 17:82214010-82214032 GGACACATGGGCCAGGTTGGGGG - Intergenic
1152883604 17:82834699-82834721 ACACACCAGGGCCTGTTTAGGGG + Intronic
1153344692 18:4012627-4012649 AAATACATAGACCAGTTTAAAGG - Intronic
1153418898 18:4882244-4882266 ATACACAGGGGCCAGTCAAGGGG - Intergenic
1155879476 18:31125977-31125999 ACACACATGACCAAGTTTAGAGG + Intergenic
1159316307 18:66778193-66778215 ACACACATGGTCCAGTTAATGGG + Intergenic
1166733842 19:45073037-45073059 AAACACATGGCCCAGCACAGTGG - Intronic
1168169841 19:54578287-54578309 ACACACCGGGGCCAGTCTAGGGG - Intronic
926482522 2:13417592-13417614 ACACACATGCACCAGTTAAGAGG + Intergenic
927043583 2:19254662-19254684 ACACACTGGGGCCTGTTTAGGGG + Intergenic
927299631 2:21496949-21496971 ACACACATGGGCCTGTTGGGGGG - Intergenic
928406804 2:31021135-31021157 GCACAGATGGGCCATTTTAGAGG + Intronic
929380315 2:41342487-41342509 ACACACAGGGGCCTGTTTGGGGG + Intergenic
929766035 2:44844676-44844698 AAACACATTGTCCTTTTTAGTGG - Intergenic
930265074 2:49190256-49190278 GGACACATGGGCCAGAATAGAGG - Intergenic
930266493 2:49205838-49205860 AAACACTTGACCCAGTTGAGGGG + Intergenic
931669662 2:64636047-64636069 AGACACAGGGGCCATTTTTGAGG + Exonic
932521599 2:72420396-72420418 ACACACTGGGGCCTGTTTAGGGG - Intronic
932868191 2:75369048-75369070 ACACACCTGGGCCAGTTAGGGGG - Intergenic
935577648 2:104727565-104727587 AAAGACATGGGCCTGTTTTATGG + Intergenic
936705041 2:115062549-115062571 ACACACTGGGGCCAGTTGAGGGG - Intronic
937068846 2:119046008-119046030 AGGCACATAGGCCAGTGTAGTGG - Intergenic
939719827 2:145634784-145634806 AAACACAAAGGCATGTTTAGAGG - Intergenic
939892900 2:147758437-147758459 TAACACATGGGACATTATAGAGG - Intergenic
942220636 2:173765739-173765761 AAATACATGGCCCAGTGTGGTGG + Intergenic
1169045661 20:2532888-2532910 AAGCAGATGGGCCAGCCTAGGGG + Intergenic
1169330576 20:4713072-4713094 ACACACAGGGGCCTGTTTGGGGG - Intergenic
1170702863 20:18719435-18719457 CAACTGATGGGACAGTTTAGTGG - Intronic
1172336143 20:34117499-34117521 AATCACCTGGACCAGGTTAGTGG - Intergenic
1173809301 20:45946584-45946606 AAACCCACAGGCCAGCTTAGGGG - Intronic
1177959226 21:27641287-27641309 AGACACAGGGCCCAGTGTAGAGG + Intergenic
1180253504 21:46605895-46605917 GAACACGGGGGCCAGTTTATGGG + Intergenic
1182603313 22:31484458-31484480 AAACACGTTGGCCAGATGAGAGG - Intronic
1182722648 22:32415874-32415896 AAAGAAATGGGTCAGTTAAGAGG + Intronic
1182900160 22:33891253-33891275 AAACAAAGGGGCAAGTTTAGTGG - Intronic
949371186 3:3336321-3336343 AACCACATGGGCCAGATGGGAGG + Intergenic
951010319 3:17669863-17669885 AAAAACATGGGACAGTCGAGAGG - Intronic
952149011 3:30566313-30566335 AAACATATAGGCCAGTTGAAGGG - Intergenic
952427913 3:33194103-33194125 GACCAGATGAGCCAGTTTAGTGG - Intronic
953826167 3:46252773-46252795 AAACACAAGAGCCAATTTAATGG - Intronic
953984068 3:47427948-47427970 AAACACCCTGGCCAGTTCAGTGG + Intronic
955208747 3:56921075-56921097 AAACTCATGGGCCAGTGCAGTGG + Intronic
957973030 3:87407127-87407149 ACACACCAGGGCCTGTTTAGGGG + Intergenic
958728291 3:97932775-97932797 AAACACATGGGACATGTTGGGGG - Intronic
959316215 3:104810489-104810511 AAACACATGGGATATTTTATGGG + Intergenic
960055687 3:113274803-113274825 AGACAGAAGGGCCTGTTTAGTGG - Intronic
960478948 3:118164234-118164256 ACACACAGGGGCCAGTTGTGGGG + Intergenic
960667858 3:120128166-120128188 AAAAACATAGGCCAGTACAGTGG - Intergenic
960770985 3:121191928-121191950 ACACACAGGGGCCTGTTTTGGGG + Intronic
961265366 3:125637427-125637449 AAACGCATGGGCCAAATTAAAGG + Intergenic
961348578 3:126282616-126282638 AAAAACATGGGCATGATTAGAGG + Intergenic
963228159 3:142883988-142884010 AGACACATAGGCGAATTTAGAGG - Intronic
968668922 4:1837535-1837557 AAACACATGTGCCAGCTTTAAGG - Intronic
971033696 4:22669427-22669449 ACACACAGGGGCCAGTTGTGGGG - Intergenic
972083627 4:35184803-35184825 ACACACCTGGGCCTGTTGAGGGG + Intergenic
972781925 4:42293715-42293737 AAAGACATGGGCCAGGTGAGTGG - Intergenic
974535755 4:63173015-63173037 AAACAAATGGGCAAATCTAGAGG + Intergenic
979662549 4:123274688-123274710 AAACATATGGGCTAATCTAGTGG - Intronic
980708869 4:136537893-136537915 AAACAGATGTCCCAGTTTAAAGG - Intergenic
981029713 4:140112236-140112258 AGACACAGGGGCCAGTTTGATGG - Intronic
982648101 4:158049304-158049326 ACACACATGGGCCTGTTGAGGGG + Intergenic
986119190 5:4815022-4815044 ACACACATGGGCCAGTTGAAGGG - Intergenic
989949326 5:50279290-50279312 ATAGTCATGGGGCAGTTTAGGGG - Intergenic
990635520 5:57721783-57721805 AAACATATGGCCAAGTTTGGGGG - Intergenic
992390161 5:76323869-76323891 ACACACCAGGGCCTGTTTAGGGG + Intronic
995383169 5:111558698-111558720 ATGCACATGGGACATTTTAGAGG - Intergenic
996292288 5:121866379-121866401 AAACACATGGCACAGTCAAGTGG - Intergenic
1001549909 5:172595300-172595322 AAGCACCAGGGCCAGTTGAGAGG + Intergenic
1001863859 5:175085453-175085475 ACACACCTGGGCCTGTTGAGGGG - Intergenic
1002417271 5:179127131-179127153 ACACACAAGGGCCAGTCCAGAGG + Intronic
1003348488 6:5293503-5293525 AATCACATGGCCCAGTGTTGTGG - Intronic
1004113099 6:12739816-12739838 ACAGACATGGGCCACTTTACTGG + Intronic
1004790201 6:19017178-19017200 CAACACATGGGACAGGGTAGAGG + Intergenic
1007872863 6:45061424-45061446 CAACACATGGGGCCTTTTAGAGG + Intronic
1010739531 6:79483668-79483690 ACACACACGGGCCTGTTGAGGGG - Intergenic
1012702909 6:102485394-102485416 AAACACATTGGCCAGAGTAAAGG - Intergenic
1015875237 6:137816046-137816068 GAAGCCATGGGCCAGCTTAGAGG - Intergenic
1017830695 6:158126350-158126372 AAGGACATGGGCCAGTTTGCTGG + Intronic
1019290984 7:250061-250083 AAACAGATGGGCCAGGAGAGTGG - Intronic
1022812518 7:33883946-33883968 GAACACATGGGACTGTTTAGTGG + Intergenic
1023951130 7:44846950-44846972 AAACAGATTGGCCAGTCGAGAGG - Intronic
1025871787 7:65441069-65441091 AAACATATCTTCCAGTTTAGAGG - Intergenic
1030435916 7:109520491-109520513 AAACACAAGGGCCAATTAAGGGG - Intergenic
1031152699 7:118073175-118073197 GATCACAGGGGCCATTTTAGAGG - Intergenic
1031267361 7:119598348-119598370 ACACACCGGGGCCAGTTGAGGGG - Intergenic
1033553389 7:142467713-142467735 AAATAAATGGGCCATTATAGGGG + Intergenic
1035345465 7:158194362-158194384 AAAAAGATGGGCCAGTCTGGGGG + Intronic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1039078887 8:33716740-33716762 AAGCATAAGGGCCAGTTGAGGGG + Intergenic
1042368245 8:67960619-67960641 AAGGACAAGGGCCACTTTAGGGG + Intronic
1042623052 8:70727260-70727282 AAAGATATGGGGCAATTTAGGGG + Intronic
1043873413 8:85460509-85460531 AAACACCTGGGCCAGGTTCATGG - Intergenic
1044509702 8:93060268-93060290 GCACACATGGGCTAGTTGAGGGG - Intergenic
1045219507 8:100184368-100184390 AAAAAGATGGGGCAGTTTATTGG + Intronic
1046432794 8:114151114-114151136 ACACACCAGGGCCTGTTTAGGGG - Intergenic
1047836386 8:128698025-128698047 AACCAAATGGGCCTGTTTAATGG + Intergenic
1047917776 8:129601097-129601119 AAAAAAATAGGCCAGTGTAGTGG - Intergenic
1048136125 8:131748062-131748084 AAACACAGAGGCTAGTTAAGAGG - Intergenic
1050973227 9:11904680-11904702 AAACTCATGGGCCACCTTATAGG - Intergenic
1052903334 9:33814263-33814285 AAACACATGAGCTAGTTCTGTGG + Intergenic
1056691208 9:88810295-88810317 ACAGACATGGGCCAGTTCTGTGG + Intergenic
1057279740 9:93701128-93701150 AAACATTTGGGCCAGTGTGGTGG - Intergenic
1058949922 9:109893816-109893838 AAACACTGGGGCCAGTCGAGGGG + Intronic
1061632971 9:131885198-131885220 AGTCACATGGGCCAGTTCTGGGG - Intronic
1186311803 X:8328141-8328163 AAGCAAATGGGCCAGGTCAGTGG + Intergenic
1186655031 X:11602984-11603006 AGTCAGGTGGGCCAGTTTAGTGG - Intronic
1187088525 X:16068036-16068058 AATCACATAGGCCAGTTTCCAGG - Intergenic
1187620853 X:21052792-21052814 AAACACATAGGCCAATTAAGTGG + Intergenic
1188178247 X:27021564-27021586 ACACACCTGGGCCTGTTGAGGGG - Intergenic
1189632806 X:42973423-42973445 AATCAGATGAGCCAGTTTATCGG - Intergenic
1190717177 X:53114613-53114635 AAACAGATGGGCCTGTTGATTGG + Intergenic
1193356524 X:80525427-80525449 AAACACCAGGGCCTGTTGAGGGG - Intergenic
1193656792 X:84208436-84208458 AAACACACAGGCTAGTTTCGGGG - Intergenic
1194637267 X:96361308-96361330 ACACACCAGGGCCAGTTGAGGGG + Intergenic
1198952522 X:142087746-142087768 AAACACCTGTGCCTGTTTAGGGG + Intergenic
1201586080 Y:15562783-15562805 AAACACATGGCTCAGTAGAGAGG + Intergenic
1201935704 Y:19408517-19408539 ATACACATGGGGCATTTCAGGGG + Intergenic