ID: 923041750

View in Genome Browser
Species Human (GRCh38)
Location 1:230324620-230324642
Sequence CTTACCACTTAGAACAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923041750 Original CRISPR CTTACCACTTAGAACAGGGT TGG (reversed) Intronic
900809800 1:4793339-4793361 CTCCCCTCTTAGAACTGGGTGGG + Intergenic
900820685 1:4885249-4885271 CTTACCACTAAGAACAAGAAAGG - Intergenic
906639569 1:47433588-47433610 CCTACCACATAGTCCAGGGTTGG + Intergenic
907909775 1:58815599-58815621 CTGATCACTCAGAACATGGTAGG + Intergenic
908472535 1:64458245-64458267 TTTACCACTTAGCACATGGCGGG - Intergenic
912490565 1:110060559-110060581 CTTTTCTCTTAGAACAAGGTGGG - Exonic
912701301 1:111880360-111880382 GGTACAACTGAGAACAGGGTGGG + Intronic
912852906 1:113142473-113142495 CTTACCACTTAACACACAGTAGG + Intergenic
913106107 1:115615570-115615592 ATTACAATTTAGAACAGGCTTGG - Intergenic
915544272 1:156587105-156587127 CTAAGCACCTAGAATAGGGTGGG - Intergenic
915544279 1:156587135-156587157 CTAAGCACCTAGAATAGGGTGGG - Intergenic
915544286 1:156587165-156587187 CTAAGCACCTAGAATAGGGTGGG - Intergenic
915544292 1:156587195-156587217 CTAAGCACCTAGAATAGGGTGGG - Intergenic
923041750 1:230324620-230324642 CTTACCACTTAGAACAGGGTTGG - Intronic
924121732 1:240806835-240806857 CTTACCACCTAGAACAGAAAAGG - Intronic
1067934037 10:50592966-50592988 CGTCCCACTTGGAACAGGGCTGG + Intronic
1068821738 10:61384803-61384825 CTTACCACATAGTATAGGTTAGG + Intergenic
1072340881 10:94448273-94448295 CATAACACTTAGAACATGTTGGG + Intronic
1072703896 10:97666051-97666073 CTTCTCAGTTACAACAGGGTAGG - Intronic
1076153888 10:128187971-128187993 TTAAGCACTTAGAACAAGGTTGG - Intergenic
1079393798 11:20044416-20044438 ATTTCCACTTAGAAAAAGGTAGG - Intronic
1084776459 11:71380153-71380175 CACACCACTTAGAACAAGGCTGG + Intergenic
1084848957 11:71922976-71922998 TCTATCATTTAGAACAGGGTAGG - Intronic
1085011656 11:73145525-73145547 TGTACCATTTTGAACAGGGTTGG + Intergenic
1085532599 11:77200916-77200938 CTCCCCACTGAGGACAGGGTGGG - Intronic
1087507793 11:99049063-99049085 TTTACTACTTAGAACAGGCATGG - Intronic
1088447577 11:109948658-109948680 CTTAGTACTTAGAACAGTTTTGG - Intergenic
1089151915 11:116370981-116371003 CCAAGCACTTAAAACAGGGTGGG + Intergenic
1091721103 12:2814521-2814543 CTCAACACTTAGAACAATGTAGG + Intronic
1092442519 12:8519394-8519416 CTTCCCACTTAGAACAGGGAGGG - Intronic
1101042476 12:100770893-100770915 TTTAGCACTTAGAACACAGTTGG + Intronic
1102092632 12:110204896-110204918 CTCAGCACTTAGAACAGTGCTGG + Intronic
1102279428 12:111607323-111607345 GGTAGCACTTAGAACATGGTTGG - Intergenic
1103256000 12:119541966-119541988 CTTAACACCTAGAACTTGGTTGG - Intergenic
1106172350 13:27298860-27298882 TTTTCCACTTAGAGTAGGGTTGG + Intergenic
1107960042 13:45549318-45549340 ATGACCACTTAGAAGAGGGAGGG + Intronic
1108001763 13:45910754-45910776 CTTACCACTTCAAACTGAGTGGG + Intergenic
1110621750 13:77603936-77603958 CTTACTACTTAAAACAGAATAGG + Intronic
1110687200 13:78388972-78388994 GATACCATTTAAAACAGGGTAGG + Intergenic
1112724368 13:102285744-102285766 CTTACAACTTACAATAGGGTAGG + Intronic
1113543530 13:111127715-111127737 CTTACCACTTAGAATGGTTTGGG - Intronic
1116503897 14:45654209-45654231 CTTATCACTTAGATCTGGGCTGG - Intergenic
1116862719 14:50007489-50007511 GTTACCACTGGGAGCAGGGTGGG - Exonic
1120416470 14:84224886-84224908 TTTACCACTTAGCACTGTGTGGG + Intergenic
1121851448 14:97224663-97224685 CTTACTACTTAAATCAAGGTGGG - Intergenic
1132416767 15:101625888-101625910 CCTCCCAATTAGAGCAGGGTAGG + Intronic
1134892282 16:17851711-17851733 CACACTACTTAGTACAGGGTTGG + Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1142610596 17:1107662-1107684 CTCCCCACTAGGAACAGGGTGGG - Intronic
1147417536 17:40304207-40304229 TTTAGCAGTTGGAACAGGGTTGG + Exonic
1149985102 17:61341284-61341306 CTCATCCCTTAGACCAGGGTGGG - Intronic
1150598588 17:66629553-66629575 CTTACCACTTTGTACAGGGCTGG + Intronic
1151421609 17:74001816-74001838 CTAATCACTTAGATCAGGCTTGG - Intergenic
1151709537 17:75794875-75794897 CTTGGCACTTAGCACAGCGTAGG + Intronic
1152266133 17:79296004-79296026 TTTCCCAATTACAACAGGGTGGG + Intronic
1153324895 18:3808587-3808609 CATACTACTTAGAACAGAGATGG + Intronic
1156657118 18:39301745-39301767 CTCACCAGATAGAACATGGTGGG + Intergenic
1159292326 18:66439468-66439490 CTTCCAACTTGGAAGAGGGTGGG - Intergenic
1165247020 19:34503631-34503653 CTTGCCACTCAGACCAGGGAAGG - Exonic
927293911 2:21431354-21431376 CCTACCACTTAGCAGGGGGTCGG + Intergenic
928953053 2:36832002-36832024 CTCACAACTTAGAAGAGGATGGG - Intergenic
929666080 2:43835035-43835057 CTTATCACCTAGAACAGGGTCGG - Intronic
932947755 2:76257098-76257120 ATTACAACTGAGAAAAGGGTAGG + Intergenic
935943626 2:108267362-108267384 CTTAGCACTTGGAACAGCTTGGG + Intergenic
938907250 2:135849425-135849447 CGTATCACTTAGAATAGGTTAGG - Intronic
939324445 2:140670379-140670401 CTTACCATTTAGAACTGCGGAGG - Intronic
942791444 2:179765830-179765852 CTTACCCCTTGGAACTGGATGGG + Intronic
943948937 2:194104141-194104163 CTTACCACTGAGGGCAGGGCGGG + Intergenic
946604259 2:221385695-221385717 TCTAGCACTTAGAACAGAGTGGG - Intergenic
946707366 2:222471579-222471601 CTTAGCACTTAGCACAGAATGGG + Intronic
1172860338 20:38044732-38044754 CTTACCAGTTAGGAAATGGTAGG + Intronic
1174576515 20:51541691-51541713 CTTACCACTCACAAGAGGATTGG - Intronic
1182654897 22:31882003-31882025 CTTCCCACTGACATCAGGGTAGG - Intronic
950206553 3:11085231-11085253 CTGACCACTTAGAGGAGGCTGGG + Intergenic
951399909 3:22219309-22219331 CTTAATACATAGAACAGGGTTGG - Intronic
952023912 3:29056134-29056156 CTTTCAACTAAGAACAGGTTTGG - Intergenic
953355513 3:42253217-42253239 CCTAACACTTAATACAGGGTTGG - Intergenic
954159060 3:48707091-48707113 CTTACCACCTAGTATAGGGCAGG - Intronic
955526012 3:59820487-59820509 CTCACGATTTAGAACAGGATGGG + Intronic
956355208 3:68383687-68383709 CTTACCACATAGAATGAGGTAGG + Intronic
969136469 4:5033225-5033247 CTTTCCACTTACAACACGGTAGG + Intergenic
970280522 4:14449747-14449769 CTTTCCACATGGAACAAGGTAGG - Intergenic
970772320 4:19628658-19628680 CTTACAACTTAGATCTGGGAGGG + Intergenic
970772449 4:19630165-19630187 CTTACAACTTAGATCTGGGAGGG + Intergenic
972558650 4:40205693-40205715 CTTACCACTTCCAGTAGGGTTGG - Intronic
974261900 4:59535885-59535907 TTTTCCCCTTATAACAGGGTTGG - Intergenic
981017250 4:139987033-139987055 CCTGCCACTTAGAAAAGGTTTGG + Intronic
981925860 4:150138569-150138591 CTCAGCACTTAGAACAGGCCAGG + Intronic
983222307 4:165054809-165054831 CTGACTCCTTAGGACAGGGTGGG - Intergenic
990399594 5:55424614-55424636 CTTACCAGTTGAATCAGGGTTGG + Intronic
995454690 5:112338703-112338725 CTCACCCTCTAGAACAGGGTTGG + Intronic
1002875626 6:1206161-1206183 CTTACCACTTAGATCACCTTCGG + Intergenic
1004155059 6:13159957-13159979 ATTACCACCTATGACAGGGTAGG - Intronic
1004773192 6:18810379-18810401 CCTTCCACGTAGAACAGAGTGGG + Intergenic
1005256488 6:24008820-24008842 CTTTTCTCTTAGCACAGGGTAGG - Intergenic
1012267426 6:97162802-97162824 CTCACCTCTTAGAACAGGTCCGG + Intronic
1013638317 6:112049306-112049328 CTTACCAGTGAGAACAAGGCAGG + Intergenic
1017200010 6:151742774-151742796 CATTACACTTAGAATAGGGTCGG + Intronic
1020152104 7:5690515-5690537 TCTACCACTTAGACCAGGGGAGG + Intronic
1021286325 7:18785581-18785603 TTTAGCACTTTTAACAGGGTAGG + Intronic
1021801170 7:24308354-24308376 GTTACCTCTGAGAGCAGGGTGGG + Intergenic
1026372162 7:69711268-69711290 ATTAACATTTAGAACTGGGTAGG + Intronic
1026394896 7:69941469-69941491 CTTAACATTTGGAACTGGGTGGG + Intronic
1027163389 7:75818183-75818205 CTTCCCTCGTAAAACAGGGTTGG - Intronic
1027803178 7:82781775-82781797 CTTCCCACAGAGTACAGGGTGGG - Intronic
1030690643 7:112529035-112529057 CTTGCCACCTACAACTGGGTGGG - Intergenic
1032296126 7:130639971-130639993 CCTACCACTGAGAAAAGGGACGG - Intronic
1033922283 7:146409032-146409054 CCTACAACTTAGAATATGGTAGG + Intronic
1034990896 7:155547604-155547626 CTGACCCCTAAGAGCAGGGTAGG - Intergenic
1045030635 8:98132160-98132182 CAAACCATTTAAAACAGGGTAGG - Intronic
1048223095 8:132561359-132561381 TCTACCCCTTAGAACAGGGCAGG - Intergenic
1050127865 9:2378190-2378212 CTGACCATTTACAAAAGGGTAGG + Intergenic
1051770301 9:20570847-20570869 CTTCCCACTTAGAAAAGGCAGGG + Intronic
1056165883 9:83940514-83940536 CTTACCACTGAGACTAGAGTAGG + Intronic
1057748994 9:97774973-97774995 TGAAACACTTAGAACAGGGTTGG + Intergenic
1186275284 X:7931504-7931526 CTTAACAAATAGAAAAGGGTAGG - Intergenic
1194315095 X:92367824-92367846 CTTACAAGCTAGAAGAGGGTGGG - Intronic
1194712292 X:97250656-97250678 CCTACCACCTAGCACAGTGTAGG + Intronic
1196375933 X:115032404-115032426 TTTACTCCTTAGAAAAGGGTGGG + Intergenic
1199033078 X:143023754-143023776 CATACCACATAAAATAGGGTAGG - Intergenic
1200978500 Y:9239280-9239302 CTTACCATTTAAAACTTGGTGGG + Intergenic