ID: 923042205

View in Genome Browser
Species Human (GRCh38)
Location 1:230327430-230327452
Sequence CTGCTGTTTCTGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 433}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923042205_923042208 1 Left 923042205 1:230327430-230327452 CCTTCTTTCCTCAGAAACAGCAG 0: 1
1: 0
2: 2
3: 34
4: 433
Right 923042208 1:230327454-230327476 ATTTCGCATGGAAGAAACACTGG 0: 1
1: 0
2: 1
3: 11
4: 149
923042205_923042212 30 Left 923042205 1:230327430-230327452 CCTTCTTTCCTCAGAAACAGCAG 0: 1
1: 0
2: 2
3: 34
4: 433
Right 923042212 1:230327483-230327505 TGTGGGAAATTGAGCTGCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 163
923042205_923042209 12 Left 923042205 1:230327430-230327452 CCTTCTTTCCTCAGAAACAGCAG 0: 1
1: 0
2: 2
3: 34
4: 433
Right 923042209 1:230327465-230327487 AAGAAACACTGGCCAGCTTGTGG 0: 1
1: 0
2: 1
3: 15
4: 211
923042205_923042210 13 Left 923042205 1:230327430-230327452 CCTTCTTTCCTCAGAAACAGCAG 0: 1
1: 0
2: 2
3: 34
4: 433
Right 923042210 1:230327466-230327488 AGAAACACTGGCCAGCTTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923042205 Original CRISPR CTGCTGTTTCTGAGGAAAGA AGG (reversed) Intronic
900173373 1:1281334-1281356 CTGCTCTCTCCCAGGAAAGACGG - Intronic
900412371 1:2518563-2518585 GCGCTGTTTCTGAGGCACGAAGG - Exonic
902731666 1:18373922-18373944 CTGCTGGTTCTAAGGGAAGAAGG - Intronic
903740102 1:25553829-25553851 CTGGGGTTTCCTAGGAAAGAAGG + Intronic
905793810 1:40804094-40804116 CTGCTGACTCAGAGGACAGAAGG + Intronic
907820954 1:57968048-57968070 CTGCTGAGTCCTAGGAAAGAAGG - Intronic
908006621 1:59734828-59734850 CTCCTGCTTCTGAGCAGAGAAGG + Intronic
908038482 1:60081812-60081834 ATGCTGATTCTGAGGCTAGAAGG + Intergenic
908050727 1:60227043-60227065 CAGCAGCTACTGAGGAAAGAAGG + Intergenic
909586771 1:77298938-77298960 CTCCTATTTCTCAGGAAAGGAGG - Intronic
909690094 1:78397768-78397790 CTGCTGGCTCTGAAGAGAGAAGG - Intronic
909892791 1:81028797-81028819 CTTATATTTCTGAGGAAGGAAGG + Intergenic
912983994 1:114407563-114407585 ATGCTGTTTCACAGGAAACATGG + Intronic
915111557 1:153567194-153567216 CTGCAGTTTCTGAGCAGGGAAGG - Intronic
915580852 1:156812430-156812452 TTGGTGTGTCTGAGGAATGATGG - Intronic
916304270 1:163311583-163311605 TTGCTGTGTCTCAGGAAATAGGG + Intronic
916471110 1:165123635-165123657 CTGCTGTTTCTGAGAGGGGAAGG + Intergenic
916633040 1:166637761-166637783 CTGCTCTTACTGAGAGAAGAAGG + Intergenic
917192315 1:172431057-172431079 CTGTTGTGTCTCAGGAAATAGGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917526888 1:175796150-175796172 CTACTGTTTCTGAACCAAGAGGG - Intergenic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918106030 1:181415886-181415908 CTAATGTTACTGAGCAAAGAGGG + Intronic
918304463 1:183233453-183233475 CTTCTATTTCTGAATAAAGAAGG + Intronic
918392105 1:184076453-184076475 TTGCTGTTTCTCAGGGAATAGGG - Intergenic
918401250 1:184164726-184164748 CTGCAGTGTCTGTGGTAAGAAGG + Intergenic
921358057 1:214305173-214305195 TTTCTGTTTTTAAGGAAAGAAGG + Exonic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
922275451 1:224073550-224073572 TTGTTGCCTCTGAGGAAAGAAGG + Intergenic
922639246 1:227210492-227210514 ATTCTGTTTCTGAGACAAGATGG - Intronic
922824525 1:228508482-228508504 CTACTGTGTCTGAGGACACATGG + Intergenic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923109715 1:230880831-230880853 TTGCTTTTTCTGAGGAAATCGGG - Intergenic
923748635 1:236726341-236726363 CTGTTGTTTCTCAGGGATGAGGG + Intronic
924479506 1:244415417-244415439 CTTCTGTTTCTTAGGAATTAAGG - Intronic
1062813500 10:482656-482678 GAGCTGTATCTGAGCAAAGAAGG + Intronic
1062841706 10:678284-678306 CTGCTTTTCCAGAGGAAAGCTGG - Intronic
1063024945 10:2168497-2168519 GAGCTGTTTCTGAGGACAGGGGG - Intergenic
1063125409 10:3132690-3132712 CTGATGTTTATGAAGAAAGAAGG + Intronic
1065886241 10:30079948-30079970 TTGCTCTTTCTGTGGGAAGAGGG - Intronic
1067168538 10:43884955-43884977 CTGCTGCTTCTGAGCCAAGCGGG - Intergenic
1067186170 10:44029845-44029867 GTGCTGTTTCAGAGGAGGGAGGG + Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068050197 10:51940666-51940688 ATTCTGTTTCTGAGGAGTGAGGG + Intronic
1069380360 10:67838030-67838052 CTCTTGTTTCCGAGGGAAGAAGG - Exonic
1069947281 10:71996657-71996679 CTGCTGGTTCTGGGGGAAGAAGG + Intronic
1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG + Intronic
1071178469 10:82955208-82955230 ATTCTGTGTCTGAGGAAAGATGG + Intronic
1071598590 10:86945105-86945127 CTGCTGTATCACAGGAAAAAGGG + Intronic
1072571905 10:96665752-96665774 CAGAGGTTACTGAGGAAAGAAGG + Intronic
1074710906 10:116176744-116176766 TTGCTGGTTGTGAGGAAGGAAGG - Intronic
1074766965 10:116706652-116706674 CTGCCCTGTATGAGGAAAGATGG - Intronic
1076079997 10:127570647-127570669 ATGCTTTTTTTAAGGAAAGATGG - Intergenic
1076442279 10:130488151-130488173 CTGCCGTTTCTCAGAAAAGATGG - Intergenic
1076742685 10:132494811-132494833 CTGCTGTGTCTCGGGGAAGAGGG - Intergenic
1077172502 11:1174209-1174231 GTGCTGTGTCTGAGGCAAGCTGG + Intronic
1078911523 11:15737044-15737066 CTGATGTTTATGAGGAATCAAGG - Intergenic
1079722399 11:23834448-23834470 CTGCTGTGTCTTAGGGAATAGGG + Intergenic
1079849262 11:25510555-25510577 CTGCTGTGTCTGTGGGAAGGTGG - Intergenic
1080637195 11:34134435-34134457 CTGGTGTGTCTGAGGGAAGCTGG + Intronic
1080928576 11:36784136-36784158 CAGCTGTTTCTGAGGATACTTGG + Intergenic
1081366605 11:42242907-42242929 CTGATGTGTCTGAGAACAGAGGG + Intergenic
1081371671 11:42311786-42311808 CTGCAGAGTCTGAGGAAATATGG + Intergenic
1082672475 11:56052490-56052512 CTGCTGTCTTTGAAGATAGAAGG + Intergenic
1083461010 11:62811885-62811907 CTGCTGGGTCTGAGGATAAAAGG - Intronic
1083594314 11:63911779-63911801 CTGGTGTCACTGAGGACAGAAGG - Exonic
1084230477 11:67749086-67749108 CTGAAGGTTCTGAGGAAAGATGG - Intergenic
1084551395 11:69845110-69845132 CTGCTGTTACTAAAGAAGGAAGG - Intergenic
1085652077 11:78277441-78277463 CAGCTGGTGCTGGGGAAAGACGG + Intronic
1086289320 11:85289271-85289293 GTGCTGGTGGTGAGGAAAGAGGG - Intronic
1086812265 11:91325069-91325091 CTGCTGTATCTGAAAAATGAGGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089711033 11:120314927-120314949 CTGCTTTTGCTGAGGACAGCAGG - Intronic
1090184969 11:124732121-124732143 CTGCTGTTTATGAGGAATTAAGG - Intergenic
1090490044 11:127152324-127152346 CTCCTGTCTCTGGGGAAGGAAGG + Intergenic
1090926049 11:131251344-131251366 CGGCTGTTTTGGAGAAAAGAGGG - Intergenic
1091100445 11:132868096-132868118 CTGCTACTTCTGTGGAAAGCGGG + Intronic
1091344558 11:134844112-134844134 CTGCTGCTTCTGGGGAGAAATGG - Intergenic
1091646230 12:2274326-2274348 CTGATGTTTCTGAGCTAGGAGGG + Intronic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1093569715 12:20653120-20653142 CAAATGTTTCTGAGGAAAAAAGG - Intronic
1093717105 12:22395402-22395424 CTACTGTTTATTAGGGAAGAAGG - Intronic
1093824584 12:23668087-23668109 CTAGTGTTTATGAGGCAAGAGGG + Intronic
1094201500 12:27799475-27799497 CCGCTGTTACTGCAGAAAGATGG - Exonic
1096099173 12:48958503-48958525 CTGCTGTAAATGAGGAGAGAGGG - Intergenic
1096561156 12:52436869-52436891 CTGTTGTTTCTGAAGCTAGACGG + Intergenic
1097163345 12:57066579-57066601 TTGCTGTTTCTCAGGGAATAGGG + Intronic
1097464272 12:59903068-59903090 ATGGTGTTTCTTAAGAAAGATGG + Intergenic
1099832650 12:87865046-87865068 TTGTTGTTTCTGAGGAAGAAAGG - Intergenic
1099876934 12:88419285-88419307 CTGATGTTTCTGTGAAGAGAAGG - Intergenic
1099977194 12:89558280-89558302 CTACTTTTTCTGAGGTAACATGG - Intergenic
1101023573 12:100578227-100578249 CTGTTCTGGCTGAGGAAAGATGG + Intronic
1101212519 12:102548790-102548812 CTGCTGTGGGTGAGGAAAGGAGG + Intergenic
1102097071 12:110249400-110249422 CTGCTGTGTCTAAAGAAACACGG - Intergenic
1102708180 12:114901111-114901133 CTGTCTTTTCTGAGGAATGAGGG - Intergenic
1102756334 12:115343970-115343992 TTTTTCTTTCTGAGGAAAGAAGG + Intergenic
1103436541 12:120931195-120931217 CCCCTGTTTCTGGGGAGAGAAGG + Intergenic
1104358474 12:128109934-128109956 CTGCTGTGACTGAGGAGTGAGGG - Intergenic
1104420937 12:128634438-128634460 CTTCTCTATCTGAGGACAGATGG + Intronic
1104897584 12:132171866-132171888 GTGCGGCTGCTGAGGAAAGAGGG + Intergenic
1105325044 13:19363230-19363252 TTGCTGTATCTCAGGAAATAGGG + Intergenic
1105357653 13:19673702-19673724 CTGCTGTTTATCAGGAAGGCGGG + Intergenic
1105725773 13:23160518-23160540 CTGCGGTCGCTGAGGAAGGACGG + Intergenic
1105899612 13:24743828-24743850 CTGCTGTGGCTGAGGAATGTGGG - Intergenic
1106480391 13:30133190-30133212 CCGCTGGCTCTGGGGAAAGAGGG - Intergenic
1107334173 13:39335496-39335518 CTGCTGTTTGTCAGTAAAGTGGG + Intergenic
1109071794 13:57778856-57778878 CTGCTGCTGCTGAGCCAAGAAGG - Intergenic
1109097243 13:58134070-58134092 CTGCTGTCTCTGAGGAATCCGGG - Intergenic
1110856200 13:80299427-80299449 CTGTTATCTCTGAGGAAACAAGG - Intergenic
1111402584 13:87760540-87760562 CTGCTTTTTCTGTGGAAAACAGG + Intergenic
1112783391 13:102926297-102926319 CTTCTTTCTCTGAGGGAAGAAGG + Intergenic
1114001318 14:18251412-18251434 CTGCAGTTTCTGCAAAAAGAGGG + Intergenic
1114257233 14:21013509-21013531 CTGATGTTAGTGAGGAGAGAGGG + Intergenic
1114382622 14:22224063-22224085 CTGATGTTTCAGAGGAATGATGG + Intergenic
1114723904 14:24913224-24913246 CTGTGGTTTCTCAGCAAAGAAGG - Intronic
1115518485 14:34209085-34209107 CTCCTGTTTAAGAGGAAAGGAGG + Intronic
1116966391 14:51019885-51019907 GTTCTGGTTCTGAGGCAAGATGG - Intronic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117739862 14:58806183-58806205 TTGCTGTTTCTGGGTATAGATGG - Intergenic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1119053277 14:71391821-71391843 CAAGTGATTCTGAGGAAAGAAGG + Intronic
1119322293 14:73739262-73739284 CTGCTGCTTCTGTGGAGGGAAGG + Exonic
1120049176 14:79845498-79845520 TTGCTGTGTCTCAGGAAATAGGG + Intronic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1121876228 14:97456078-97456100 CAGCTGTTTGCCAGGAAAGAAGG - Intergenic
1123024520 14:105418513-105418535 GTGCTGTCTCTGGGGAGAGAGGG - Intronic
1123172758 14:106389935-106389957 CTGCTTTTTATCAGGAAAGGGGG + Intergenic
1123838280 15:24219594-24219616 CTACAGAGTCTGAGGAAAGAGGG + Intergenic
1124970297 15:34483175-34483197 CTGTTCTCTCTGAGGAATGAGGG - Intergenic
1125492678 15:40159963-40159985 CTGATGATTCAGAGGAAAGAAGG + Intergenic
1125775811 15:42212627-42212649 ATGCAGTTTCTGAAGAAAGTAGG - Intronic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1128064432 15:64755579-64755601 CTGCTGTTTGTGAGGGCAGGGGG + Intronic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1128345480 15:66850158-66850180 CTGCGGCTTCTCAGCAAAGAAGG + Intergenic
1128708705 15:69856318-69856340 TTGCTGCTGCTCAGGAAAGATGG - Intergenic
1129575446 15:76738612-76738634 CTGCTGTGTCTCAGGGAATAAGG + Intronic
1130570314 15:85036892-85036914 CTGCTGTTTCTGAGGCAGGGAGG - Intronic
1130761279 15:86822674-86822696 ATGCAGTTTTTCAGGAAAGAAGG + Intronic
1130801979 15:87274294-87274316 CTGCTGCTTCTGATCACAGAGGG + Intergenic
1131082672 15:89549873-89549895 ATGCTATTTCTGAATAAAGAGGG + Intergenic
1131443571 15:92476969-92476991 CTGGTGTTTCTGGGGGAGGATGG + Intronic
1131638507 15:94263572-94263594 CTGGTGTTCCTAAGGACAGAAGG - Intronic
1131670449 15:94614351-94614373 CTGCTGGTTCTCAGGGAATAGGG + Intergenic
1134315291 16:13113346-13113368 CTGCTGTCTCTTTGGTAAGAGGG + Intronic
1134887486 16:17806570-17806592 CTTCTGGTTATGAGGAAGGAGGG - Intergenic
1137839591 16:51627886-51627908 CTGCTCTTTCTGTGGCATGAAGG + Intergenic
1139152902 16:64406120-64406142 ATGTTGTTTCAGAGAAAAGAAGG - Intergenic
1139752322 16:69116701-69116723 CTGCTGCTTTTGGGGAATGAGGG + Exonic
1141253832 16:82382736-82382758 GTGCTGTTTCTGAGTAACAATGG + Intergenic
1141305068 16:82855157-82855179 CTGCTGACTCTTAGGGAAGAGGG - Intronic
1141334820 16:83144852-83144874 CTGCTGTCTGTTAGGAGAGAAGG - Intronic
1142808491 17:2384409-2384431 CAGCTGTTTCTGGAGAGAGAAGG + Exonic
1142919621 17:3172795-3172817 CTCCTCTGTCTGAGGAAAGGTGG + Intergenic
1143021848 17:3921010-3921032 CTGGGGGTGCTGAGGAAAGATGG - Intergenic
1143641330 17:8199785-8199807 CTGCTGTTTCTCAGAGAAGAGGG + Intergenic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1144275802 17:13667077-13667099 CTGCTGTGCCTGAGGTCAGATGG - Intergenic
1144280425 17:13720740-13720762 ATAGTGTTTCTGAGGACAGAAGG - Intergenic
1144328055 17:14200531-14200553 CTCCATTTTCTGAGGAAGGAGGG + Intronic
1146066789 17:29642319-29642341 CTGACATTTCTGAGGAAACATGG + Intronic
1146545708 17:33736253-33736275 CTGCCATTGCTGAGGAAAGTGGG + Intronic
1148383978 17:47221445-47221467 CTGCTTTCACTGAGAAAAGAGGG + Intronic
1149084588 17:52699913-52699935 CTCCTGTTGGTGAGGAATGAGGG - Intergenic
1149086217 17:52719397-52719419 CTGCTATTTCAGTGGAAAGAAGG - Intergenic
1149623078 17:58060594-58060616 CTCATGTTGCTGAGGACAGATGG - Intergenic
1150030108 17:61724585-61724607 CTGCTGCTTCACATGAAAGATGG + Intronic
1152194250 17:78907371-78907393 TTGTTGTGTCTCAGGAAAGAGGG + Intronic
1152249467 17:79204029-79204051 CTGCTTTCTCTTAGCAAAGATGG - Intronic
1152575040 17:81136296-81136318 CTGCTGGCTCTGAGGACAGGAGG - Intronic
1153015029 18:575951-575973 CTGCTCTTTGTTAGAAAAGAAGG - Intergenic
1153197581 18:2617609-2617631 CTTCTGTTTCGGAGTAAAGATGG - Intergenic
1153682989 18:7518035-7518057 CTTCAGTTGCTGAGGACAGATGG - Intergenic
1154558313 18:15788105-15788127 CTGCAGATTCTAAGAAAAGAAGG - Intergenic
1154905862 18:20564312-20564334 CTGCAGATTCTAAGAAAAGAAGG + Intergenic
1154920275 18:20794109-20794131 CTGCAGATTCTAAGAAAAGAAGG - Intergenic
1155008884 18:21755289-21755311 CTTTTGTTTCTGAGGGAAAATGG + Intronic
1156110638 18:33722136-33722158 CTGCTCTGTCTTAGGAAATAGGG - Intronic
1157238271 18:45984357-45984379 CTGCTGTTTGTGAGTGAAAAAGG + Exonic
1157312894 18:46565551-46565573 CTGCAGATACTGAGGAATGACGG - Intronic
1157396509 18:47346050-47346072 CTGCTGCTCCTTGGGAAAGAGGG + Intergenic
1157598218 18:48876593-48876615 CTCCTGTTTCAGAGGCCAGAGGG - Intergenic
1158309116 18:56139825-56139847 CTGCTGCTGCAGAGGAATGAGGG - Intergenic
1158343740 18:56493668-56493690 GTGATGTTTCTAATGAAAGATGG + Intergenic
1158619640 18:59021555-59021577 CAGCTGTGGGTGAGGAAAGATGG - Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160114534 18:76065017-76065039 TTGCAGGTTCTGAGCAAAGAAGG - Intergenic
1160799757 19:962327-962349 CTGCTGCTGCTGAGGGGAGAGGG - Intronic
1160845780 19:1165414-1165436 CTGCTGTCCCTGAGAACAGAAGG + Intronic
1161302589 19:3550028-3550050 CTGCTGCTTCTGAGGCCAGCAGG - Intronic
1163019974 19:14476659-14476681 GTGCTGTTTCTGGGGCAAGGAGG - Intergenic
1164398221 19:27884762-27884784 GTGCTGTTACTGAGGATAAAGGG - Intergenic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1165462848 19:35954222-35954244 CTTCTGTGCCTGAGGAAGGAGGG - Intergenic
1165834077 19:38743846-38743868 CTCCTGGGTCTGAGGAAGGAAGG - Intronic
1166297248 19:41895181-41895203 CTCCTGTGTCTGAGGGAGGAGGG + Intronic
1166306307 19:41938628-41938650 CTCCTGGGTCTGAGGAAGGAAGG - Intergenic
1166306504 19:41939183-41939205 CTCCTGGGTCTGAGGAAGGAAGG - Intergenic
1166306696 19:41939738-41939760 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166525347 19:43507098-43507120 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1166525375 19:43507172-43507194 CTCCTGGGTCTGAGGAAGGAAGG - Intronic
1166531556 19:43546318-43546340 CTCCTGTGTCTGAGGGAGGAAGG - Intronic
1166532651 19:43552330-43552352 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1166569491 19:43784766-43784788 CTCCTGGTTCTGAGGGAGGAGGG + Intergenic
1166569510 19:43784819-43784841 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1166569532 19:43784891-43784913 CTCCTGGTTCTGAGGGAGGAGGG + Intergenic
1166662148 19:44654170-44654192 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1166672864 19:44722125-44722147 CTGCCATTTCTGAGGCCAGAAGG + Intergenic
1166685463 19:44793728-44793750 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1166686776 19:44800935-44800957 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686903 19:44801367-44801389 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686965 19:44801583-44801605 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166687027 19:44801799-44801821 CTACTGGGTCTGAGGAAGGAGGG - Intergenic
1166688474 19:44809516-44809538 CTCCTGGGTCTGAGGAAAGAGGG - Intronic
1166695831 19:44851098-44851120 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1167265042 19:48478969-48478991 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167265799 19:48482732-48482754 CTCCTGGGTCTGAGGGAAGAAGG - Intergenic
1167298285 19:48664397-48664419 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1167314278 19:48754967-48754989 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167314291 19:48755004-48755026 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167314374 19:48755261-48755283 CTTCTGTGTCTGAGGGAGGAGGG - Intronic
1167327632 19:48835456-48835478 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1167435511 19:49476354-49476376 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1167489153 19:49781843-49781865 CTTCTGGTTCTGAGGGAGGAGGG + Intronic
1167489248 19:49782238-49782260 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167689127 19:50974916-50974938 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1167689188 19:50975083-50975105 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1167690102 19:50980034-50980056 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167743382 19:51337717-51337739 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1167746233 19:51353358-51353380 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746247 19:51353395-51353417 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746261 19:51353432-51353454 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746276 19:51353469-51353491 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746291 19:51353506-51353528 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746306 19:51353543-51353565 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746321 19:51353580-51353602 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746336 19:51353617-51353639 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746398 19:51353802-51353824 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746452 19:51353950-51353972 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167795398 19:51704964-51704986 CTCCTGGTTCTGAGGGAGGAGGG - Intergenic
1168147844 19:54429742-54429764 CTCCTGAGTCTGAGGGAAGAGGG + Intronic
1168236063 19:55063709-55063731 CTGCTGAGTCTGAGGGAGGAGGG + Intronic
1168252175 19:55147351-55147373 CTCCTGGGTCTGAGGAAGGAGGG + Intronic
1168252214 19:55147460-55147482 CTCCTGGGTCTGAGGAAGGAGGG + Intronic
1168291707 19:55360495-55360517 CTTCTGTGTCTGAGGGAGGAGGG - Intronic
1168306349 19:55438152-55438174 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1168313879 19:55475429-55475451 ATGCTGTTTCTCAGGCCAGAAGG - Intergenic
925168581 2:1736367-1736389 CTGCTGTGTCTCAGGGAATAAGG + Intronic
925512325 2:4641679-4641701 CCAGTGTTTCTGAGCAAAGACGG - Intergenic
926219001 2:10922777-10922799 CTGCACTTTCTGAGGAAAGAGGG + Intergenic
926643929 2:15268194-15268216 CTCCCATTTCTGAGGAGAGAAGG + Intronic
926834853 2:17007190-17007212 CTTCTGTTTCTCAGGGAATAGGG - Intergenic
927364151 2:22274709-22274731 CTCCAGTTTCAGAGGAAATAAGG + Intergenic
927436492 2:23070981-23071003 ATGCTGGTTTTGAGGAAGGAGGG + Intergenic
927578558 2:24220887-24220909 CTGCTGTCTCTCATGAGAGATGG - Intronic
928046145 2:27934449-27934471 CTGCTGTGTCTCAGGGAATAAGG - Intronic
928793360 2:34985704-34985726 CTTCTGTTTCAGAGGATTGATGG - Intergenic
929329817 2:40668625-40668647 CTGTTGTCTCTGGGGAAGGAAGG - Intergenic
931876716 2:66521479-66521501 CTGTCGTTTCTCAGCAAAGAAGG + Intronic
932311473 2:70745679-70745701 CTGTGCTTTCTCAGGAAAGAGGG - Intronic
934138375 2:89019910-89019932 GTGCTGTTTCTGTGGAGAGCAGG - Intergenic
934230877 2:90180715-90180737 GTGCTGTTTCTGTGGAGAGCAGG + Intergenic
936522473 2:113219945-113219967 GTGCTGTTTGTGATGGAAGAAGG - Intronic
938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG + Intergenic
943105407 2:183540866-183540888 GTGCTGTCTCTAAAGAAAGAAGG - Intergenic
944025840 2:195166366-195166388 CAGTTGTTTCTCAGGAAATAGGG - Intergenic
944817755 2:203396198-203396220 TTTCTGTTTCAGAGAAAAGAGGG - Intronic
945582170 2:211609162-211609184 ATGCTCTGTCTGGGGAAAGAGGG - Intronic
946133051 2:217622394-217622416 CAGCTGTTTGTGAGGAATGCTGG - Intronic
946299779 2:218815531-218815553 CTGCTTTTTCTGTTCAAAGAGGG - Intergenic
1168890948 20:1295111-1295133 CTGCTGTTAATGTGGAAGGAGGG + Intronic
1169417618 20:5431458-5431480 CTGCAGAATCTGAGGAGAGAAGG + Intergenic
1171161588 20:22929877-22929899 AGGCTGTTTCTGAAGAAATAGGG - Intergenic
1171307494 20:24118780-24118802 GTGCTGGTCCTGATGAAAGAAGG + Intergenic
1171940885 20:31328694-31328716 ATGCAGTTTGTGAGGAAAGCAGG - Intergenic
1172461158 20:35119917-35119939 CTTCTGTCTCTTAGAAAAGATGG - Intronic
1172834551 20:37864594-37864616 CTGCTGGTTCTGGGGAAGGCTGG - Intronic
1173657726 20:44711901-44711923 CTTCTATCTCTGAGGCAAGAAGG - Intergenic
1174728855 20:52894443-52894465 ATGCAGTTACTCAGGAAAGAAGG + Intergenic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1176364997 21:6027410-6027432 CTGCTGTTTCTGAGTCCACAGGG - Intergenic
1177010234 21:15722942-15722964 CTTCTGTTTCTGTAAAAAGAGGG + Intergenic
1177991041 21:28036821-28036843 CTGGCCTTTCTGAGGAAAGCAGG + Intergenic
1178367580 21:32000124-32000146 CAGCTGGTTCTGTAGAAAGAGGG + Exonic
1179139794 21:38714743-38714765 CTGGTGTTTCTGAGGTTGGAAGG + Intergenic
1179758521 21:43511135-43511157 CTGCTGTTTCTGAGTCCACAGGG + Intergenic
1179919609 21:44500315-44500337 CTCCTGTATCTGAGGACGGAGGG - Intronic
1180071763 21:45440337-45440359 TTGCTGTCTGTGAGGAAAGCGGG + Intronic
1180089248 21:45525355-45525377 CTGCTGCTTCTGAGAAGAGCTGG - Intronic
1182480484 22:30605683-30605705 CTGGAGGTTCTGAGGAAGGAGGG - Intronic
1182486169 22:30640470-30640492 ATGCTGGCTCTGATGAAAGAGGG + Intronic
949155106 3:817336-817358 CTGGTGATTCTCAGGAAACAGGG + Intergenic
949734259 3:7153083-7153105 CTGCAGTTTCTTCTGAAAGAGGG - Intronic
950008679 3:9706961-9706983 CTCCCGTTTCAGAGGAAAGGTGG - Intronic
952047021 3:29334751-29334773 CTGCTGTTGCTGAGACAATATGG + Intronic
953085641 3:39664082-39664104 CTCCTGTTTCTGAGAAAGTAGGG + Intergenic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953510059 3:43526826-43526848 CTGCTGTTACTGATTAAAGTAGG - Intronic
954115147 3:48462998-48463020 CTGCAGTTTCTAAGCACAGAAGG - Intronic
954400490 3:50317134-50317156 TGGCTGTCCCTGAGGAAAGAAGG - Intergenic
954533110 3:51337831-51337853 CTGCTGCTTCTGGTGATAGATGG + Intronic
954828980 3:53402210-53402232 CTGCTGGTTCTGAAACAAGATGG + Intergenic
955650971 3:61193406-61193428 CTGTTGTATCTGTGCAAAGAAGG - Intronic
957047041 3:75384107-75384129 TCGAAGTTTCTGAGGAAAGATGG - Intergenic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
957269454 3:78010605-78010627 CTGCAATTTCTGTAGAAAGAGGG - Intergenic
958653042 3:96962668-96962690 AGGCTGTTTCTGAGCAAATAAGG - Intronic
958833567 3:99117837-99117859 CTTCTGTTTGTGAGGAAGGTGGG + Intergenic
959613150 3:108317355-108317377 CAGCTGTTGCTGATTAAAGATGG + Intronic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
962087363 3:132205814-132205836 CTGCTGTTTGGGAGGAAAGTTGG - Intronic
962604596 3:137023188-137023210 CTGTTCTTTCTCAGGGAAGAAGG + Intergenic
962891006 3:139673045-139673067 CTGCTGTCTGAGAGGAAAGAAGG - Intronic
963054028 3:141169267-141169289 ATACTGTTTCTCAGGGAAGAGGG - Intergenic
963256062 3:143145989-143146011 CTGCTGCTTCTGAGGGGACAAGG + Intergenic
963341757 3:144044004-144044026 ATGCTGTATTTGAGGCAAGAAGG - Intronic
964120091 3:153174216-153174238 CTGTTATTTGTTAGGAAAGATGG - Intergenic
964447580 3:156776325-156776347 CTTGTGTTTCTGAGGAAGGTGGG + Intergenic
965014754 3:163142643-163142665 ATGCTGTTTCTGGGAAAAAAAGG - Intergenic
965078286 3:164004753-164004775 CTGATTTATCTGAGAAAAGAAGG + Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
965342897 3:167512026-167512048 CTGCTGGCTCTGAGGAATCAAGG + Intronic
965898881 3:173614513-173614535 CTGCTCATTGTCAGGAAAGATGG - Intronic
966106108 3:176335810-176335832 CTGCTGTGTCTCAGGGAATAGGG - Intergenic
967649940 3:191973744-191973766 CTGCAGCTGCTAAGGAAAGAGGG + Intergenic
967725923 3:192862326-192862348 CTTATGTTTCAGAGGAGAGAGGG - Intronic
969102417 4:4779044-4779066 CCACTGTTTGTGAGGACAGAGGG - Intergenic
969328928 4:6461767-6461789 CAGCACTTTCTGAGGGAAGAGGG - Intronic
970140543 4:12977396-12977418 CTGCTGTTTCTGGAGGAAGTGGG - Intergenic
970945197 4:21682733-21682755 CTGTTGTATCTCAGGAAATAGGG + Intronic
971558837 4:28047951-28047973 ATGCTGCTGCTGTGGAAAGAGGG + Intergenic
971804483 4:31337623-31337645 CTGATGATTCTGTGGAAACATGG + Intergenic
972156772 4:36172819-36172841 CTGGTGTTTCCCAGGAAAGCTGG - Intronic
972973975 4:44610627-44610649 CTGCTGCTTATGAGGAATGATGG + Intergenic
974448715 4:62021888-62021910 TTGCTGTGTCTCAGGGAAGAGGG - Intronic
974605740 4:64147311-64147333 CACATGCTTCTGAGGAAAGAGGG + Intergenic
975186898 4:71414012-71414034 CTGCTTTTTCAGTGCAAAGATGG + Intronic
975600325 4:76093111-76093133 ATGCTGTTTCTGACTGAAGATGG - Intronic
975760319 4:77613663-77613685 CTGGAGTGTCTGAGGAAAGGCGG + Intergenic
976058538 4:81098626-81098648 CTGTTGTGTCTCAGGAAATAGGG + Intronic
976764417 4:88584341-88584363 CTGATGTTTCTGAGGGTAAATGG - Intronic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
977359364 4:95983364-95983386 ACGTTGTTTCTGAGAAAAGAGGG - Intergenic
977416833 4:96743922-96743944 CTGTGGTTTCTGAGTCAAGAGGG + Intergenic
979647827 4:123092851-123092873 TTGCTGTTTCTGATGGAGGAGGG - Intronic
979670040 4:123352095-123352117 GTGCTGTTTCTCAGGGAACACGG - Intergenic
981683146 4:147423226-147423248 TTTTTCTTTCTGAGGAAAGATGG - Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
981959528 4:150519724-150519746 CTGCTGTTTCATAGGATAGGTGG + Intronic
982031667 4:151307606-151307628 TTGCTGTCTCTGAGGATAGTTGG + Intronic
982177482 4:152719512-152719534 TTCCTGTTTCTGATAAAAGAGGG - Intronic
982371395 4:154637362-154637384 CTTGTGGTTCTGAGGAAAGAAGG + Intronic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
982819147 4:159924789-159924811 CTGATGATTTTGAGCAAAGAAGG + Intergenic
984108217 4:175576782-175576804 AAGCTGTTACTGAGGAAACATGG - Intergenic
984588477 4:181589838-181589860 TTCCTGTTTCTGATGACAGAAGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
989375061 5:40752524-40752546 TTGCTGTGTCTCAGGAAATAGGG + Intronic
990373663 5:55147930-55147952 CTGGTGTTTCTTAGAGAAGATGG - Intronic
990620060 5:57550004-57550026 CTGCTGGTTCTGAGGAATCTGGG - Intergenic
990697481 5:58436852-58436874 CTGTTGTGTCTCAGGAAATAAGG + Intergenic
990875887 5:60485186-60485208 GTGCTTTTTCTGTGGGAAGAGGG + Intronic
992677804 5:79123243-79123265 AAGCTGTTTCAGAGGAATGAAGG + Intronic
992916129 5:81454777-81454799 TTTCTATTTCTGAGGTAAGAAGG + Intronic
992933809 5:81680008-81680030 CAGCAGTGTCTGAGGACAGAAGG - Intronic
994350727 5:98742872-98742894 CTGCTGGCTCTGAGGAATGTGGG + Intergenic
994916703 5:105990095-105990117 ATACTGTTTCTCAGGAAGGATGG + Intergenic
995089902 5:108161807-108161829 TTGCTCTTGCTGATGAAAGATGG - Intronic
995688610 5:114798744-114798766 TTGCTGTTTCTCAGTAAAGATGG + Intergenic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
996546805 5:124688034-124688056 CTGCTTTTTCAGAATAAAGAAGG - Intronic
997373573 5:133381068-133381090 CTGTTGTTTCCAAGGAAAGCTGG + Intronic
997529674 5:134574091-134574113 CTGCTGGTGCTGAGGCAGGAAGG + Intronic
999470665 5:151852056-151852078 CTGCCTTGTATGAGGAAAGAAGG - Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1000353420 5:160370578-160370600 CTGCTGCCGCTGAGGAAAGCCGG - Exonic
1000391911 5:160731214-160731236 TTGCCGTTTGTGAGTAAAGATGG + Intronic
1000733131 5:164861336-164861358 CTGCTCTTTATGAAGAAATAAGG - Intergenic
1001890979 5:175338317-175338339 TTGGTGTATCTGAGGAGAGAGGG - Intergenic
1002766026 6:239724-239746 GGGCTGTTTCTGAGGATAGAGGG - Intergenic
1003441864 6:6150285-6150307 CTGTCGTTTCTGACGAAAGCAGG + Intronic
1005426335 6:25706630-25706652 CTCCAGATTCTGAGGCAAGAAGG + Intergenic
1005532709 6:26723419-26723441 GTTCTGTTGGTGAGGAAAGAGGG + Intergenic
1005538086 6:26778245-26778267 GTTCTGTTGGTGAGGAAAGAGGG - Intergenic
1005801472 6:29429423-29429445 CATCTGTTTCTGAGGATAGTGGG + Intronic
1007123029 6:39399473-39399495 ACGCTGCTTTTGAGGAAAGATGG + Intronic
1007493737 6:42244539-42244561 CTCCCTTTTGTGAGGAAAGATGG - Intronic
1009006728 6:57797852-57797874 GTTCTGTTGGTGAGGAAAGAGGG - Intergenic
1009008940 6:57820615-57820637 GTTCTGTTGGTGAGGAAAGAGGG - Intergenic
1009860103 6:69317704-69317726 CAGAAGATTCTGAGGAAAGAAGG - Intronic
1009960781 6:70517910-70517932 TTGCTGTTTCTCAGGGAATATGG - Intronic
1010964332 6:82186197-82186219 TTGTTGTTTCTTAGGAAATAGGG - Intronic
1012472344 6:99586516-99586538 CTGCTGTGTCTCAGGGAATAGGG + Intergenic
1012473225 6:99593653-99593675 CTCCTCTTTCTGAGGCAAGTAGG + Intergenic
1012873617 6:104699905-104699927 CTACTGTTTCCAAGGAAACAGGG - Intergenic
1013789474 6:113820193-113820215 ATGCTGTTTCTGAAGGAAGAAGG - Intergenic
1015334326 6:132020173-132020195 CTTCTGTGTCTGAGGACACACGG - Intergenic
1016713209 6:147196638-147196660 CTGGGCTTTCTGAGGAGAGAGGG + Intergenic
1017209485 6:151838912-151838934 TTGCTATTTCTGAGGAAAATGGG + Intronic
1018569875 6:165197603-165197625 CTGCTGTTTCAAAGTAAAGTAGG - Intergenic
1019332099 7:465316-465338 CTCCTGCTTCTGAGGAATGCTGG + Intergenic
1019957673 7:4428228-4428250 TTGCTGTTACAGAGGAAGGAAGG - Intergenic
1021034265 7:15777957-15777979 TTACTGTTTCTGAGGAAATTTGG + Intergenic
1022123340 7:27331626-27331648 CTGGAGTTTCTGAAGAAAGAAGG - Intergenic
1022581651 7:31561114-31561136 GAGCTATTTCAGAGGAAAGATGG + Intronic
1023339621 7:39205879-39205901 CTGCTTTATCTGAAGAATGAGGG - Intronic
1023911562 7:44560251-44560273 CTGCAGGTTCTGATGGAAGAGGG + Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1026230741 7:68481415-68481437 ATTCTGTCTCTGAAGAAAGAAGG + Intergenic
1027998417 7:85457930-85457952 GGTCTGTTTCTGAGGAAAGACGG + Intergenic
1028591421 7:92499948-92499970 TTGCTGTTACTAAAGAAAGATGG - Intronic
1029283117 7:99449422-99449444 CTGCTGCCTCTGGGGACAGATGG - Intronic
1029493753 7:100886186-100886208 CTGCTGTTTCTCTGGCAAGCGGG + Intronic
1030889500 7:114982016-114982038 CTGCTTTTTCTGTGGAATGAAGG + Intronic
1031115890 7:117667981-117668003 CTGGAGCTTCTGTGGAAAGAAGG - Exonic
1031297147 7:120015057-120015079 CTGTTCTTTCTGAGGAAGTAGGG - Intergenic
1031974972 7:128087870-128087892 TTTCTGTTTCTGGGGATAGAGGG - Intronic
1032423402 7:131801269-131801291 CTGATGTATCTGAGGAGGGATGG - Intergenic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1033244948 7:139710007-139710029 CTGTTGTTACTCAGGAATGAAGG - Intronic
1034924266 7:155108326-155108348 ATGCTGTGTCTGAGCAGAGAAGG + Intergenic
1035778690 8:2209695-2209717 CTGCAGGTGCTGAGGACAGAGGG + Intergenic
1036391175 8:8325457-8325479 CTTCTGTTTCTAATGAAATAAGG + Intronic
1037853265 8:22350246-22350268 GTGCTATTACTGAGAAAAGATGG + Intronic
1037889729 8:22617528-22617550 CTGTTGCTTCTGAGGGATGATGG + Exonic
1038606261 8:29007976-29007998 CTGCTTTTTCTGATGCTAGAGGG + Intronic
1039792688 8:40888183-40888205 CTGATGTTTCTGGAGAAGGAGGG - Intronic
1041578927 8:59434200-59434222 CATCTGTTTCTGTGGCAAGAAGG + Intergenic
1042974897 8:74457493-74457515 CTCCTGTTTCTATGGAGAGAAGG + Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1048129304 8:131676279-131676301 CTGTTGTGTCTCAGGAAACAGGG + Intergenic
1048220427 8:132536176-132536198 CTGCTGGTTCTGTGGAACCAAGG - Intergenic
1048222683 8:132556546-132556568 CTGCTGTTTCTGAGAGCAGAAGG + Intergenic
1048508057 8:135038530-135038552 CTGCTGGTCCTGGGGCAAGATGG - Intergenic
1053228340 9:36381952-36381974 CTGGTGTTTCTGAAGCATGAAGG - Intronic
1053350750 9:37411893-37411915 GTGCAGGTTCTGAGGAAAAAGGG - Intergenic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1054946302 9:70799513-70799535 CTCCTTTTCCAGAGGAAAGAAGG - Intronic
1056202247 9:84288179-84288201 CTGCAATTTCAGAAGAAAGAAGG + Intronic
1057261970 9:93589843-93589865 CTGCTGTTTGTGTGGAGAGAGGG - Intronic
1058290634 9:103236582-103236604 CTGTTGTTTATGCGGAAACAAGG - Intergenic
1058293008 9:103266705-103266727 ATGCTGTTTCTAGGGACAGAAGG + Intergenic
1060444482 9:123675236-123675258 ATGCTGTTTTGGAGGAAAGGGGG - Intronic
1062352711 9:136147139-136147161 CTGCTTTTTTTAAGAAAAGAGGG - Intergenic
1185755250 X:2648220-2648242 CTGTTGTTTCTGCGCAAATATGG + Intergenic
1186046144 X:5538442-5538464 CTGCAGATTCTGAGAGAAGAGGG - Intergenic
1187068456 X:15864313-15864335 CTGCTATTTCTGGGGCAAGCAGG - Intergenic
1187638390 X:21259700-21259722 CTGCTGCTCCAGAAGAAAGATGG + Intergenic
1190107455 X:47570417-47570439 GTTCTGTTTCTGGGGAAAAATGG - Intronic
1190183599 X:48216031-48216053 TTGCTGTGTCTCAGGAAATAGGG + Intronic
1190193657 X:48298085-48298107 TTGCTGTGTCTCAGGAAATAGGG - Intergenic
1190199529 X:48348440-48348462 TTGCTGTGTCTCAGGAAATAGGG - Intronic
1190204369 X:48391011-48391033 TTGCTGTGTCTCAGGAAATAGGG + Intronic
1190206167 X:48404392-48404414 TTGCTGTGTCTCAGGAAATAGGG - Intronic
1190210207 X:48440661-48440683 TTGCTGTGTCTCAGGAAATAGGG + Intergenic
1190666304 X:52698923-52698945 TTGCTGTGTCTCAGGAAATAGGG - Exonic
1190673114 X:52759487-52759509 TTGCTGTGTCTCAGGAAATAGGG + Exonic
1193835662 X:86340506-86340528 CTGCTGTGTCTCAGGGAATAGGG - Intronic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1196067314 X:111478393-111478415 TTGCTGTTTCTCAGGGAATAGGG + Intergenic
1196514080 X:116549104-116549126 TTGATGTTGCTGAGGAATGAGGG + Intergenic
1197305948 X:124842375-124842397 CTGCTGCTTGTGAGTAAAGGTGG - Intronic
1198048909 X:132929920-132929942 CTGATGTCTCTGGGGGAAGAGGG - Intronic
1198520372 X:137446314-137446336 GTGCTGTTTATCAGGAAAGAAGG - Intergenic
1200063455 X:153494044-153494066 CTGCTCTTGCTGAGGGAAGAAGG + Intronic
1200573936 Y:4865920-4865942 TTGGTGTTTCTGTGGGAAGAAGG - Intergenic
1200783415 Y:7237344-7237366 CTTCTGTGTGTGAGAAAAGAGGG - Intergenic