ID: 923042409

View in Genome Browser
Species Human (GRCh38)
Location 1:230328631-230328653
Sequence TGTGATGTTCAAGATCGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923042408_923042409 -10 Left 923042408 1:230328618-230328640 CCATGTCTGTCTCTGTGATGTTC 0: 1
1: 0
2: 3
3: 25
4: 349
Right 923042409 1:230328631-230328653 TGTGATGTTCAAGATCGACATGG 0: 1
1: 0
2: 1
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923042409 Original CRISPR TGTGATGTTCAAGATCGACA TGG Intronic
904282145 1:29428058-29428080 TGTGATGTTTAAATTAGACAAGG + Intergenic
907585599 1:55615187-55615209 TTTGTTGTTCACGATCTACATGG - Intergenic
923042409 1:230328631-230328653 TGTGATGTTCAAGATCGACATGG + Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1064455213 10:15481180-15481202 GGTGATGTGCAAGACAGACATGG - Intergenic
1072106028 10:92274925-92274947 TGAGATGTTCAAGATTGATGAGG + Intronic
1074315297 10:112356083-112356105 AATGATATTCAAGATCTACACGG + Intergenic
1079127926 11:17732046-17732068 TGTCCTGTTCAGGATCCACAAGG + Intergenic
1079164146 11:18022061-18022083 TGTGATGATGGAGATCGATAGGG - Intronic
1081178859 11:39963229-39963251 TCTGACGTTCAAGAGAGACAGGG - Intergenic
1081594402 11:44449350-44449372 GGAGATGTTCAAGACCCACAGGG - Intergenic
1086891254 11:92260708-92260730 TGTAAACTTCAAGATAGACAAGG - Intergenic
1094735115 12:33225257-33225279 TGTGATGCTTATGATGGACAAGG + Intergenic
1101819423 12:108172434-108172456 TCTGAGGTTCCAGATGGACACGG - Intronic
1106852943 13:33814969-33814991 TATGATTTTGAAGATCAACAAGG + Intergenic
1107675742 13:42795050-42795072 TGTGGTTTTCAATAGCGACAGGG - Intergenic
1113228209 13:108181852-108181874 GGTGATGGTCAAGGTCAACATGG - Intergenic
1116212715 14:41968545-41968567 TGTGATGTTGCAGATTGGCAGGG - Intergenic
1121339438 14:93096440-93096462 AGTGATGGCCAAGATGGACAAGG - Intronic
1125491036 15:40148619-40148641 TGTGATGGTGAAGAGAGACAGGG - Intergenic
1126143780 15:45457734-45457756 TGTCATATTCAAAATCGACCAGG - Intergenic
1127838177 15:62807491-62807513 TGTAATGTTCAAGGTCGCTATGG + Intronic
1127882845 15:63173422-63173444 TGTTCTGTTCTAGATCGCCACGG - Intergenic
1132018698 15:98341288-98341310 TGTGAGGTTCAAGAACTGCACGG - Intergenic
1135472297 16:22742249-22742271 TGTAATGTATAAGATGGACAAGG - Intergenic
1137545983 16:49403902-49403924 TGTGCAGTTCAAGAAAGACAAGG + Intergenic
1138215000 16:55196630-55196652 TGTGATGTTCCATAGTGACAGGG - Intergenic
1141120119 16:81347351-81347373 TTTGATGTTAAAGATGTACAAGG + Intronic
1147342941 17:39765906-39765928 TGTGATGTTCACGATTCACATGG - Exonic
1158485245 18:57860414-57860436 TGGGATGTTCAAGATTTCCAAGG - Intergenic
1165124134 19:33582053-33582075 TGGGAAGTTCAAGATCAACAAGG - Intergenic
1168140828 19:54385717-54385739 AGTGATGATCAAGACAGACAAGG - Intergenic
927394054 2:22629140-22629162 TGTGTTTTTCAAGATAGAAAAGG - Intergenic
930186508 2:48417408-48417430 TTTGAAGTTCAAGATCCACCTGG + Intergenic
932989761 2:76772272-76772294 TGGGAAGTTCAAGATCGAAATGG - Intronic
940893386 2:159056815-159056837 TGTGATATTCAAGCTAGACCTGG - Intronic
943816203 2:192258820-192258842 TGTGATGATAAAGATAGATATGG - Intergenic
946848062 2:223878716-223878738 TGTCATGTCCCAGATCTACAAGG + Exonic
1173868351 20:46327262-46327284 TGTCATCTTCATGATAGACATGG - Intergenic
1176009394 20:62884538-62884560 GGTGATGTTAAAGATCATCACGG + Intronic
1183527834 22:38334559-38334581 TGATTTGTTCAAGATCCACATGG - Intronic
1184258621 22:43301737-43301759 TGTGATGCTCAAAACAGACAGGG - Intronic
950180118 3:10906017-10906039 TGAGATGTTCAAGAGATACATGG - Intronic
953504829 3:43475250-43475272 TGTAAGGTTCAAGACCGAGAAGG - Intronic
955196812 3:56812017-56812039 TGTGATGAGCAAGATAGATATGG - Intronic
956055009 3:65289462-65289484 TGTGATGTGCAAAACAGACATGG + Intergenic
957167211 3:76690511-76690533 TGGGAAGTTCAAGATCAATATGG - Intronic
957400271 3:79702854-79702876 TCAGATGTACAAGATCCACAAGG - Intronic
962167853 3:133068917-133068939 TGTGAGGCTCAATATAGACAGGG + Intronic
962941348 3:140127456-140127478 TGTGACATTCAAGATCCAGAAGG - Intronic
970045246 4:11845360-11845382 TGTAATGTTCAATACTGACATGG - Intergenic
972569529 4:40297772-40297794 GGTGGTGCTCAAGATAGACATGG - Intergenic
972813533 4:42617745-42617767 AGTGATGTTTAAGATCGCCTTGG - Intronic
973001794 4:44961183-44961205 TGTGGGGGTCAAGATGGACAGGG + Intergenic
973742257 4:53929510-53929532 TGTGATTTTCAAGAAAGGCATGG - Intronic
975954960 4:79826221-79826243 TGTAATGTTCGAGCTCGAGAAGG - Intergenic
979157396 4:117413837-117413859 TGTGATGTTCCTGATCACCATGG + Intergenic
980235793 4:130104411-130104433 TGTGATTTTTAATATCAACAAGG - Intergenic
981173572 4:141653862-141653884 TGAGATGTTCAATATCCAAAAGG + Intronic
986976044 5:13395267-13395289 TGTGATGTTCATGATCGAGATGG - Intergenic
987770396 5:22294931-22294953 TGTAATCATCAAGAACGACAGGG + Intronic
988262257 5:28903118-28903140 TGTGTTGTTCAAGATTGAATGGG - Intergenic
989675244 5:43965791-43965813 TGAGATGTTCAAGCTTGATAGGG - Intergenic
993982879 5:94564149-94564171 TGTGGTATTCAAGATAGAAATGG - Intronic
1006429553 6:33987378-33987400 TGTGATGGTGAAGAACGCCATGG + Intergenic
1007355708 6:41314396-41314418 TGTGAATTTCTAGATCGAAAAGG + Intergenic
1008839856 6:55889429-55889451 TGAGAAGTTCAAGATCAAGATGG + Intergenic
1009535855 6:64883980-64884002 TGTGATGATCAAGGCTGACATGG - Intronic
1010303825 6:74292862-74292884 TGTAATGTTCCAGATCTAAAAGG + Intergenic
1012343030 6:98152336-98152358 TCTTATGTTCAGGATCTACAAGG - Intergenic
1012937136 6:105380110-105380132 AGTGATTTTCAAGATCTGCAAGG - Intronic
1015102757 6:129500653-129500675 TGAGATTTTCTAGATGGACAAGG - Intronic
1015103402 6:129507539-129507561 TGGGTTGTTCCAGATCGGCAGGG - Exonic
1015570668 6:134618159-134618181 TGTCATTTTCAAAATAGACAAGG + Intergenic
1016592043 6:145756542-145756564 AGAGATGTTCAAGATAGACAGGG + Intergenic
1016751849 6:147639052-147639074 TGTGATTCTAAAGATAGACAAGG + Intronic
1018726305 6:166615740-166615762 TCTGATGTTCAAGATGGTCCAGG - Intronic
1020727985 7:11841067-11841089 TGTGTTGTTCAAGAGAGAGAAGG - Intergenic
1022885772 7:34642194-34642216 TGTGATTTTCATGATGGAGATGG + Intergenic
1026279921 7:68913266-68913288 TGTGGTGCTCCAGATGGACATGG - Intergenic
1027741166 7:82007613-82007635 TGTGACGTTGAAGCTCAACATGG - Intronic
1032575818 7:133053163-133053185 TGTGATGTCCAAGAGTGACAGGG - Intronic
1039947705 8:42144246-42144268 TGTGATCTTCAAGAATGTCAAGG - Intergenic
1046568504 8:115932136-115932158 TTTGATGTTCAAGATTGATGTGG - Intergenic
1046830793 8:118743649-118743671 TTTGGTGTTGAAGATGGACAAGG + Intergenic
1050620434 9:7446688-7446710 TGTGATCTCCAATATCTACAGGG - Intergenic
1052418247 9:28205558-28205580 TGTGATATTCAAAGTAGACAAGG - Intronic
1057044314 9:91873161-91873183 TGTTAAGTTCAAGAATGACAGGG - Intronic
1185950464 X:4426898-4426920 TGTTAAGTTCAAAATCTACAGGG + Intergenic
1186078387 X:5904837-5904859 TGTGACCTTAAAAATCGACAGGG - Intronic
1186283668 X:8021293-8021315 TGAGCTGCTCAAGATTGACAAGG - Intergenic
1189676435 X:43465328-43465350 TGTGAGGTTCAAGATGTAAATGG - Intergenic