ID: 923045894

View in Genome Browser
Species Human (GRCh38)
Location 1:230355408-230355430
Sequence ATTTGGAGAGGTGCCGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923045894_923045901 30 Left 923045894 1:230355408-230355430 CCTTCTGCGGCACCTCTCCAAAT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 923045901 1:230355461-230355483 TTTATTTTTCCCTTGCATCCAGG 0: 1
1: 0
2: 2
3: 33
4: 444
923045894_923045897 -6 Left 923045894 1:230355408-230355430 CCTTCTGCGGCACCTCTCCAAAT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 923045897 1:230355425-230355447 CCAAATGTTTGACCCCAGCATGG 0: 1
1: 0
2: 1
3: 26
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923045894 Original CRISPR ATTTGGAGAGGTGCCGCAGA AGG (reversed) Intronic