ID: 923046689

View in Genome Browser
Species Human (GRCh38)
Location 1:230361178-230361200
Sequence ATGAGCACTGTGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923046689_923046698 -1 Left 923046689 1:230361178-230361200 CCCTCCACCTCCACAGTGCTCAT 0: 1
1: 0
2: 0
3: 29
4: 351
Right 923046698 1:230361200-230361222 TGTGTTGCGGGGGATAACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923046689 Original CRISPR ATGAGCACTGTGGAGGTGGA GGG (reversed) Intronic
900661752 1:3788192-3788214 AAGAGCAGAGTGGAGGCGGATGG - Intronic
901220171 1:7579193-7579215 AGGAGGACTGTGAGGGTGGAGGG - Intronic
901725459 1:11238484-11238506 ATGGCCACTGATGAGGTGGATGG + Exonic
901815376 1:11790615-11790637 AGCAGCACTGTGGAGGAGGAAGG + Exonic
902234222 1:15047430-15047452 ACGTGCAGTGGGGAGGTGGAGGG + Intronic
902564632 1:17303212-17303234 ATGAACACTTTGCAGGAGGAAGG + Intergenic
902725305 1:18331772-18331794 ATGCTGACTGTGGAGATGGAGGG + Intronic
903966802 1:27095851-27095873 ATGGGGAGTGTGGATGTGGAAGG - Intergenic
904092832 1:27957075-27957097 ATGAGGACTCTGGATTTGGAGGG + Intronic
904757065 1:32773761-32773783 GCAAGCACTGAGGAGGTGGATGG + Exonic
906138770 1:43520641-43520663 AGGAGCAGTGGGGAGCTGGATGG + Intergenic
906205310 1:43983445-43983467 ATGGGCACTGTGGGGGTGTGAGG + Intronic
906731437 1:48084861-48084883 AAGGGCACAGTGGAGGTGGGTGG + Intergenic
907396407 1:54193415-54193437 GTGAGCCATGTGGAGATGGAGGG + Intronic
908494943 1:64685430-64685452 TTGTACACTGTGGAGGTGGAGGG + Intronic
908897274 1:68914400-68914422 ATGTGCACTGTGATGGAGGAGGG - Intergenic
908948054 1:69523955-69523977 ATGAGCTCTGGGGAGGTGAGAGG + Intergenic
909481479 1:76132135-76132157 CTGTGCCCTGTGGGGGTGGACGG - Intronic
909579376 1:77216839-77216861 GTAAGAACTTTGGAGGTGGAAGG - Intronic
910438201 1:87226747-87226769 ATCAGCAGTGTGGAGTGGGATGG + Intergenic
910442343 1:87265710-87265732 ATGGGGACTGAGAAGGTGGAAGG + Intergenic
911035031 1:93533459-93533481 ATGACCAATGAGGAGGAGGAAGG + Intronic
911240112 1:95455811-95455833 CTGAGCTCTGGGGAGGTGGTCGG + Intergenic
914665923 1:149832499-149832521 CTGAGCAGAGTGGAGGAGGAGGG + Intergenic
914669842 1:149861295-149861317 CTGAGCAGAGTGGAGGAGGAGGG - Intronic
915591835 1:156875281-156875303 CTGGGCTCTGTGGGGGTGGAGGG + Intronic
915910803 1:159914079-159914101 AAAATCACTGTGGAGGTGGAGGG - Intergenic
918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG + Intergenic
919860540 1:201736985-201737007 TTGACTACAGTGGAGGTGGAGGG - Intronic
921095620 1:211884945-211884967 ATGAGCATTCAGAAGGTGGAGGG - Intergenic
921149670 1:212389746-212389768 AAAAGCATTGTGGAGATGGATGG + Intronic
921155951 1:212438962-212438984 ATGACAACTGAGAAGGTGGAGGG - Intronic
921847880 1:219903460-219903482 AAGAGCACTGTGGAGAAAGAGGG + Intronic
922712109 1:227842058-227842080 ATCAGTGCTGTGGAGGTGGGGGG - Intronic
922881510 1:228984797-228984819 AGGAGCACTGAGGAGGTGCCAGG + Intergenic
923033612 1:230268683-230268705 CTGGGCCCTGTGGAGGTGGCAGG + Intronic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923049519 1:230381031-230381053 GTAAGCACTGTGCACGTGGATGG - Intronic
923471483 1:234294836-234294858 TAGAGCTCTGTGGAGGTGGGAGG + Intronic
923774262 1:236964338-236964360 ATGAGAACTGTGGAGAGGGCAGG - Intergenic
924518492 1:244785856-244785878 ACAAGCACTGAGGAGGGGGATGG - Intergenic
1062972283 10:1657769-1657791 ATGAACTCCCTGGAGGTGGAAGG + Intronic
1063493927 10:6489643-6489665 GTGAGCACAGTGGAGGGGCAGGG + Intronic
1063988867 10:11537743-11537765 GTGAGCACTGCCGGGGTGGAAGG + Intronic
1065679928 10:28218933-28218955 AAAAGTGCTGTGGAGGTGGAGGG - Intronic
1065750156 10:28878663-28878685 GTGAGCACTGTGTTGGGGGAGGG + Intronic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1067549683 10:47225698-47225720 CTGAGCGCTGGGGATGTGGAGGG - Intergenic
1069537510 10:69265772-69265794 AGGATCACTGTGGGTGTGGACGG + Exonic
1070168185 10:73913454-73913476 AGGAGGACTGAGGAGGTGGGGGG + Intronic
1070562386 10:77577801-77577823 ATGTGAACTGTGGAGGGGGCAGG - Intronic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1073476285 10:103756128-103756150 CTGGGAACTGTGGAGGTGAAGGG + Intronic
1073932117 10:108587808-108587830 TTTATCACTGTGGAGGAGGAGGG + Intergenic
1074701069 10:116093083-116093105 ATAAGCACTGGGGAGGAGGGAGG - Intronic
1074850744 10:117437503-117437525 GTGATGACTGTGGAGGCGGATGG + Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075330362 10:121569800-121569822 ATGACCACTGAAGGGGTGGAGGG - Intronic
1075422274 10:122310451-122310473 CTGCTCCCTGTGGAGGTGGAGGG + Intronic
1075792958 10:125098584-125098606 ATTGGCACTGTGAAGGTGCAGGG - Intronic
1076067076 10:127457312-127457334 ATCAGTACTGTGGTGGTGGGGGG - Intergenic
1076342807 10:129761158-129761180 ATGAGAACTGTGGATGCGAATGG + Intronic
1076400450 10:130180704-130180726 AGCAGCAGTGTGGAGGTGGTGGG - Exonic
1076675525 10:132145737-132145759 AGGAGCCCTGGGGAGGAGGATGG + Intronic
1077018926 11:408940-408962 CGGACCACTGTGGAGGTGGTGGG - Intronic
1077167801 11:1151685-1151707 CTGGGCACTGTGGAGATGCATGG + Intergenic
1077807167 11:5601966-5601988 ATGATCACTGTAGAGGATGAGGG + Intronic
1077927871 11:6699467-6699489 ATGCACACTGTGGGGGTTGATGG + Intergenic
1078412155 11:11133347-11133369 AAGAACTCTGTGGAGCTGGATGG + Intergenic
1079488503 11:20961326-20961348 ATGAGCACGTTGGAAATGGATGG - Intronic
1080633710 11:34105209-34105231 ATCAGTACTGTGGGGGTGGAGGG + Intergenic
1082787090 11:57323297-57323319 ATGGGAACTGAGGAGGTGGTTGG - Intronic
1083296807 11:61719396-61719418 AAGAGCACGGTTGAGGTGCAGGG - Intronic
1083327158 11:61878628-61878650 AGAAGCCCTGTGGAGGAGGAGGG + Exonic
1083720625 11:64601905-64601927 CTGAGCTCTGGGCAGGTGGACGG - Exonic
1083772113 11:64873628-64873650 CAGAGCACTGTGGAGATGGGAGG + Intronic
1084360794 11:68667460-68667482 AGGGGTACAGTGGAGGTGGAGGG + Intergenic
1085415218 11:76315196-76315218 ATGAGGACTCTGGTGGAGGAGGG + Intergenic
1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG + Intronic
1086160495 11:83717045-83717067 ATCAGGAGTGGGGAGGTGGAGGG - Intronic
1087539570 11:99498572-99498594 CTGAATACTGTGGAGGTGGGTGG - Intronic
1088545575 11:110955509-110955531 ATGTGCAATGAGGAGGGGGATGG + Intergenic
1088812922 11:113403603-113403625 CTGAGCAGTGTGGATGTAGAAGG - Intergenic
1089288081 11:117420360-117420382 CTGGGCCCAGTGGAGGTGGATGG - Intergenic
1089491909 11:118889146-118889168 GTGAGCACTGGGGAGGAGCAGGG - Intronic
1090410829 11:126508523-126508545 ATGAGCCCTGGGATGGTGGAAGG + Intronic
1091597480 12:1887892-1887914 CTAACCACTGTGGAGGAGGAAGG - Intronic
1091756300 12:3054538-3054560 ACGAGCACTGTGGAGGCGCCAGG - Intergenic
1093542871 12:20308595-20308617 ATGAGAACTAGGCAGGTGGAGGG - Intergenic
1093937923 12:25020774-25020796 GTGGGCACTGTGGGGGTGGGGGG - Intergenic
1094487491 12:30936643-30936665 GTGAGCACTGCATAGGTGGATGG + Intronic
1095398153 12:41784555-41784577 ATGAGGCCTGAGGAGTTGGATGG - Intergenic
1096325760 12:50659822-50659844 ATGAGCGCTGTGCAGGTGCCTGG - Intronic
1096473597 12:51894983-51895005 CTGAGCAGGTTGGAGGTGGAGGG - Intergenic
1099271738 12:80519525-80519547 ATGGGCACTTTGAAGGAGGAGGG + Intronic
1100282399 12:93130409-93130431 ATGAGCATTTTGGCAGTGGATGG - Intergenic
1101724189 12:107375743-107375765 AAGAGGGCAGTGGAGGTGGAAGG - Intronic
1102683967 12:114709920-114709942 ATGAGCAATCTGGGGGTGGAGGG + Intergenic
1105318228 13:19288809-19288831 ATTAGCATGGTGGAGGGGGAAGG - Intergenic
1106593841 13:31120570-31120592 AAAAGCACTCTGGAGATGGATGG + Intergenic
1107594285 13:41946509-41946531 AATAGCACTGAGGAGCTGGAAGG + Intronic
1108211717 13:48146059-48146081 GGGAGCAGGGTGGAGGTGGAGGG - Intergenic
1108312361 13:49207204-49207226 AAGAGCACTGTGGTGCTGTAGGG - Exonic
1109981402 13:69913102-69913124 ATGAGCACTGTGAGGGAGAAAGG - Intronic
1110310817 13:74047171-74047193 ATGACCACTGCTGATGTGGAGGG - Intronic
1111753834 13:92367857-92367879 ATGAGGACGGTGCAGGTGGGTGG + Intronic
1114665066 14:24372787-24372809 ATGAGCTGAGTGGGGGTGGAAGG - Intronic
1114756843 14:25269353-25269375 ATGGCCACTGTGGGGATGGAGGG + Intergenic
1114967452 14:27980924-27980946 ATAAACACTGTGCATGTGGAGGG - Intergenic
1115366507 14:32563480-32563502 ATTAGTACTGTGGGGGGGGAAGG + Intronic
1117733525 14:58747197-58747219 ATGAGCAGTGGGGAGGTCGTGGG + Intergenic
1117851363 14:59973730-59973752 GTGGGAACTGTGGATGTGGAGGG + Intronic
1118014483 14:61644597-61644619 AGGAACACTGATGAGGTGGAAGG - Intronic
1119627568 14:76193030-76193052 AGGAGCAGGGTGGTGGTGGAAGG + Intronic
1119762434 14:77161090-77161112 ATAAACACTGGGGAGGTGGCTGG - Intronic
1122072921 14:99216443-99216465 ATAAGGGCTGTGGAAGTGGACGG - Intronic
1122261657 14:100526887-100526909 ATGATGACAGTGGAGGTGGTGGG - Intronic
1123170882 14:106371829-106371851 ATGAGGGCTGAGGAGATGGATGG - Intergenic
1124351173 15:28956659-28956681 AGGAGAGCTCTGGAGGTGGATGG - Intronic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125767429 15:42144987-42145009 ATGAGGGCTGTGAAGGTGAACGG + Intronic
1125995242 15:44153600-44153622 AAAAAGACTGTGGAGGTGGATGG + Intronic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1127863688 15:63014602-63014624 ATGAGCACTAGGGATGGGGAGGG + Intergenic
1128646451 15:69382102-69382124 AGGAACAGTGTGGAGGAGGAGGG + Intronic
1129001541 15:72339311-72339333 ATTAGCACTGGGGAGTTGCAGGG - Intronic
1130360654 15:83181833-83181855 AGGAGGATTGTGGAGGAGGAGGG - Intronic
1130627196 15:85527601-85527623 ATGAGCATTTTAGAGGAGGAAGG - Intronic
1131131209 15:89901603-89901625 ATGACCACTGTGTTGGTGGTGGG - Exonic
1131229039 15:90647060-90647082 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131229081 15:90647208-90647230 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131229106 15:90647289-90647311 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131229115 15:90647318-90647340 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131229132 15:90647373-90647395 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131541637 15:93279799-93279821 ATGTGCACTGTGGTGGGGGAGGG - Intergenic
1131942858 15:97585763-97585785 ATCAGAACTGAGGAGGTGGCTGG - Intergenic
1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG + Intronic
1133064271 16:3195033-3195055 GTGAGCACTCTGGTGGCGGAAGG + Intergenic
1133397741 16:5461859-5461881 ATGAGCTCAGTGAAGCTGGATGG - Intergenic
1133898182 16:9949096-9949118 GGGAGCACCGTGGAGGTGGAGGG - Intronic
1134128770 16:11634231-11634253 AAGAGCAGTTTGGAGGTGAAAGG - Intronic
1134761993 16:16722749-16722771 ATTACCACTTTGGAGGAGGAAGG - Intergenic
1134984065 16:18636421-18636443 ATTACCACTTTGGAGGAGGAAGG + Intergenic
1137355315 16:47756866-47756888 ATGAGCAGTGGGGACTTGGAGGG + Intergenic
1137848390 16:51713998-51714020 ATGTGCACTTTTAAGGTGGAAGG + Intergenic
1138020034 16:53470464-53470486 CTGAGCACTGAGGGGCTGGATGG - Exonic
1138641861 16:58393914-58393936 ATGAGCCCTGTGGACTTGGAGGG - Intronic
1139132555 16:64163936-64163958 TTTAGCACTTTGGATGTGGAAGG + Intergenic
1139838727 16:69861069-69861091 CTGTGCACAGTGGAGGTTGATGG + Intronic
1139962801 16:70727713-70727735 AAGAGCTTTGTTGAGGTGGAGGG - Intronic
1140222152 16:73051526-73051548 ATTAGCACTGTAGGGATGGATGG - Intronic
1141852782 16:86658772-86658794 TTGAGCACGGTGGGGCTGGATGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1143974721 17:10821305-10821327 GAGAGCTGTGTGGAGGTGGAGGG + Intergenic
1145884036 17:28370487-28370509 ATTAGCACCGTGGATCTGGAGGG + Exonic
1146308902 17:31751910-31751932 ATGAACATTCTGGAGGTAGATGG + Intergenic
1146570835 17:33951231-33951253 AGGGCCACTGTGAAGGTGGAAGG - Intronic
1147980808 17:44272844-44272866 CTGAGCAGTCTGGGGGTGGATGG + Intergenic
1148126289 17:45238850-45238872 GTGAGAACTGTGGAGAAGGAGGG + Intronic
1150258143 17:63765958-63765980 GAGACCACTGTGGAGTTGGAAGG - Exonic
1152496148 17:80673412-80673434 GTTATCACTGTGGAGGTGGAGGG + Intronic
1153597133 18:6738881-6738903 ATGAGCATTATGGTGGTAGATGG - Intronic
1155160503 18:23191532-23191554 TTGGGAACTGTGGGGGTGGAAGG + Intronic
1155451164 18:25964083-25964105 ATGAGGGCTGTGTAGGAGGATGG - Intergenic
1157112347 18:44833015-44833037 CTGGGGACAGTGGAGGTGGATGG + Intronic
1157556300 18:48615271-48615293 CTGAGAGCTGTGGAGGTGGACGG + Intronic
1158302351 18:56066067-56066089 CTTAGCATTGGGGAGGTGGAGGG + Intergenic
1159982569 18:74803263-74803285 ATCAGCACTGTGGTGGTTGTGGG + Intronic
1161084061 19:2325895-2325917 CTGAAGCCTGTGGAGGTGGACGG - Intronic
1161148762 19:2695573-2695595 AGGGGCACCGGGGAGGTGGATGG + Intronic
1162660571 19:12165252-12165274 GTGAGCACTATGGGGGTAGAGGG + Intronic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1163812020 19:19439066-19439088 ATGAGCACAGTGGAGGGAGCAGG + Intronic
1164601401 19:29566095-29566117 ATGGGCACAGTGGAGGGGGCAGG + Intergenic
1164831082 19:31321346-31321368 AGGGGCACTGTGAAGTTGGAAGG - Intronic
1166385187 19:42376669-42376691 ACGAGTACTGTGGGGGTGGTGGG + Exonic
1166745659 19:45140768-45140790 ATGACCAGAGTGGATGTGGAGGG + Intronic
1166987923 19:46673239-46673261 TGGAGAACTGGGGAGGTGGAGGG + Intergenic
1167011830 19:46813678-46813700 AGGAGAAGGGTGGAGGTGGAGGG - Intergenic
1167519820 19:49947590-49947612 AAGAGAACTGTGGAGGTGGCTGG + Intronic
1168262121 19:55201460-55201482 ATTAGCACCGTGGAGGATGAAGG + Intronic
1168435049 19:56310022-56310044 AAGAGCCCTGTAGAGGTGGATGG + Intronic
926389014 2:12368387-12368409 AAGACCAAGGTGGAGGTGGAAGG - Intergenic
926586201 2:14688313-14688335 CAGAGCACTTTGGAGTTGGAAGG + Intergenic
928403310 2:30994814-30994836 AAGAGCGATGTGGAGCTGGAAGG + Intronic
928913722 2:36449252-36449274 GGGAGCATTGTGGAGCTGGAAGG + Intronic
928916932 2:36482073-36482095 CTGAGCTCTGTTGAGGTGGAGGG - Intronic
929489674 2:42385165-42385187 ATCATCACTGAGGATGTGGAAGG + Intronic
929853431 2:45613940-45613962 TTAGGCACTGTGTAGGTGGAGGG - Intergenic
932311301 2:70744467-70744489 ATGACCTCTGAAGAGGTGGAAGG + Intronic
932466781 2:71929163-71929185 ATGATCCCTGTGGTGGTGGTGGG - Intergenic
932784879 2:74591506-74591528 ATAGGCACTGTGGTGGGGGAGGG + Intronic
933171669 2:79132284-79132306 ATAAACACAGTGGAGGAGGAAGG + Intergenic
934653501 2:96105327-96105349 TGGAGCACTGTGCTGGTGGAGGG + Intergenic
935553086 2:104479033-104479055 ATGAGCAGTGTGGTGTAGGAGGG + Intergenic
935580213 2:104750140-104750162 CTGAGGCCTGTGGAGGTTGAAGG + Intergenic
935625517 2:105169291-105169313 CTAAGCACTGTGGGGGTTGATGG + Intergenic
936388082 2:112048168-112048190 ATAAGAACTTGGGAGGTGGAGGG + Intergenic
936899899 2:117470694-117470716 ATGCTCACTGTGGTGGTGGTGGG + Intergenic
937307194 2:120879525-120879547 ATGAGCAGTTAGGAGGAGGATGG + Intronic
937524763 2:122754766-122754788 ATGAGCCTTGTTGAGGTTGAGGG - Intergenic
937950019 2:127377513-127377535 ATGAGCAATGTGGAGGCAGTGGG + Intronic
938140940 2:128794164-128794186 ATGAGGACTGGGGAGGTGGTTGG - Intergenic
940667991 2:156632437-156632459 TAGAGCACTGTGCAGTTGGATGG - Intergenic
940885904 2:158989002-158989024 ATGGGGACTGTGGAGTTGCAGGG + Intronic
941200010 2:162496395-162496417 ATGCGCACTGGGGGGATGGAGGG + Intronic
942571869 2:177323182-177323204 GTGAGAACAGTGGAGGAGGAGGG - Intronic
942860430 2:180603438-180603460 ATGATCACTGTAGAGGGGTAGGG + Intergenic
944491953 2:200266936-200266958 ATAAGCACTGTGAAGATCGAGGG - Intergenic
945451584 2:210001328-210001350 ATGAGCATTGGAGAGGTGTAGGG + Intergenic
946080580 2:217115154-217115176 ATGAGCACTGTGCCTCTGGATGG - Intergenic
946262648 2:218507676-218507698 ATGAGAATGATGGAGGTGGAGGG + Intronic
946276895 2:218638409-218638431 AGGTGCACTGTGGGGGTGGTGGG + Exonic
947517606 2:230821236-230821258 ATGAGCACGGGGGCGGTGGGGGG - Intergenic
1169061951 20:2666911-2666933 ATCAGCACTGTGAACCTGGATGG + Intergenic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1171120839 20:22568014-22568036 ATCAGGACTGAGGAGGAGGAAGG + Intergenic
1171166193 20:22974087-22974109 AAGAGGACTGTGGAGGGTGAGGG - Intergenic
1171396674 20:24838894-24838916 CTGAGCCCTGGTGAGGTGGATGG + Intergenic
1174734617 20:52954211-52954233 ATGAGCACTGAGGAGCAGGAGGG - Intergenic
1176064611 20:63188104-63188126 ATCAGCCCTGGGGAGGTGGAAGG + Intergenic
1178782987 21:35623866-35623888 ATGACCACAGTGGAGGGGGAAGG - Intronic
1179627622 21:42657605-42657627 CTCAGCACTGGGGAGCTGGAGGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180658596 22:17446019-17446041 ATGGGCCCTGTGGATGTGGAGGG + Intronic
1181341781 22:22186697-22186719 AGAAGCACAGTGGAGGTGGAGGG + Intergenic
1181881332 22:25982651-25982673 AGCAGCAATGTGGATGTGGATGG - Intronic
1182009456 22:26988295-26988317 GTGAGGACTGTCCAGGTGGATGG + Intergenic
1182062015 22:27405157-27405179 CTGCAAACTGTGGAGGTGGAAGG - Intergenic
1182434869 22:30324168-30324190 ATGGGTACTGTGGAGATGGTGGG - Intronic
1183631009 22:39032510-39032532 AACAGGACTGGGGAGGTGGATGG - Exonic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184725170 22:46340349-46340371 ATGAGTACTGTAGAGTTTGAGGG + Intronic
1185203582 22:49523508-49523530 AGGAGGACTGTGCAGGAGGATGG - Intronic
1185220454 22:49626872-49626894 ATGTGCACAGTGGACGTGGAAGG - Exonic
1185406848 22:50657091-50657113 TTGAGAACTGGGGAGGTGGCCGG - Intergenic
950099429 3:10347934-10347956 AGGAGGCCTGTGGAGGAGGAAGG - Intronic
950141056 3:10615657-10615679 ATGAGCAAGTTGGATGTGGATGG - Intronic
951262840 3:20532185-20532207 ATGAAACCTGTGCAGGTGGATGG - Intergenic
953051464 3:39348128-39348150 ATTAGCACTGTGGGGGTTGGGGG + Intergenic
954601778 3:51875995-51876017 ATGAGGACGGTGGAATTGGAGGG + Intergenic
954689006 3:52385990-52386012 GTGAGCACTCAGGAGGTGGAAGG + Intronic
954792409 3:53143083-53143105 CTGGACACTGTAGAGGTGGAGGG + Intergenic
954966833 3:54619308-54619330 ATGTGCACTGCTTAGGTGGAGGG + Intronic
955598173 3:60614358-60614380 CCCAGCACTTTGGAGGTGGATGG + Intronic
955735242 3:62031862-62031884 GTGAGCTCTGTGGAAGTGGCGGG + Intronic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
956881833 3:73519048-73519070 ATGAGGGCTGTGGCTGTGGAGGG - Intronic
958921831 3:100115216-100115238 TTGAGCACTGGGCAGGTGGTAGG - Intronic
959832965 3:110886354-110886376 ATGAGCACTGTGAACCGGGAGGG + Intergenic
959907880 3:111730636-111730658 AAGAGCAATTTGGAGATGGAAGG + Intronic
960300315 3:115995370-115995392 CTGAACACTGTGGAAGAGGAAGG - Intronic
960519483 3:118638581-118638603 CAGAGCCCTGTGGAGCTGGAAGG + Intergenic
960544018 3:118891341-118891363 ATCAGCACTGTGAAGTTGGAGGG + Intergenic
960987752 3:123291760-123291782 AGGAGCACCGGGGAGCTGGAGGG - Intronic
961008343 3:123419865-123419887 ATGAGCACGGGGGAAGTGCAAGG - Intronic
961450379 3:126999807-126999829 ATGAGCCCTGTGGTGGTGGGAGG + Intronic
961558478 3:127712693-127712715 TTGAGCACTGTGCAGGGGCATGG + Intronic
962650543 3:137484532-137484554 AGAAACAGTGTGGAGGTGGATGG - Intergenic
962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG + Intronic
963828072 3:149977051-149977073 CTGAGCATTGTGGAGCAGGAGGG + Intronic
965157554 3:165083966-165083988 ATGTGAACTGTGGACTTGGATGG + Intergenic
965553541 3:169996524-169996546 AAGAGCAGAGTGGAGCTGGAGGG - Exonic
965556674 3:170025640-170025662 ATGAGAACTGAGGATGAGGAAGG + Intergenic
965608896 3:170524392-170524414 ATGAGCACTGTGATGGGGGTAGG + Intronic
965822841 3:172701870-172701892 AAGAGCTCTGTGGAGGAGAAAGG - Intronic
966863073 3:184241405-184241427 GTGAGGACTCGGGAGGTGGAGGG + Intronic
968426008 4:523762-523784 CTGAGCACTTCGGAGGTAGAGGG - Exonic
969517361 4:7655006-7655028 ATGAGGGCTGTGGAGGATGAGGG + Intronic
969549261 4:7853504-7853526 ATGAGGACTGGGGAAGAGGAGGG - Intronic
970126417 4:12817340-12817362 ATGGGCACTGTGGACCTGGTGGG - Intergenic
970200724 4:13601774-13601796 ATAAGCAGTGAAGAGGTGGATGG - Exonic
971770932 4:30896043-30896065 ATAAACCCTGAGGAGGTGGAGGG + Intronic
972234026 4:37109053-37109075 ATGAGAACTGTCGATGTTGAGGG - Intergenic
972283281 4:37623652-37623674 ATCTGAAATGTGGAGGTGGAGGG - Intronic
972309378 4:37865883-37865905 ATGAGCACCATGGTGTTGGAGGG - Intergenic
972821403 4:42705947-42705969 AGGAGGCCTTTGGAGGTGGAGGG - Intergenic
975094502 4:70442443-70442465 ATGACCACTGTTGGGGTGGTGGG - Intronic
975889447 4:79009367-79009389 ATGAGCACTTTTGTGGTTGATGG + Intergenic
976108118 4:81641225-81641247 ATGGGGATTCTGGAGGTGGATGG - Intronic
976147559 4:82057058-82057080 ATGAGCACTATGAAGGAGAAAGG + Intergenic
976465273 4:85360806-85360828 CTGAGCAGGGTGGTGGTGGAAGG + Intergenic
977151203 4:93514406-93514428 GTGTGTACTGTGGAGGTGGGGGG - Intronic
981825950 4:148941904-148941926 ATGAGCACCTAGGAGGTGGGAGG - Intergenic
982199140 4:152943180-152943202 ATGAACATGGTGGAGATGGAGGG - Exonic
983837778 4:172413744-172413766 TTGAGCACTTTGGAAATGGAGGG - Intronic
984006784 4:174320933-174320955 ATGATGACAGTGGAGATGGAGGG + Intronic
984604269 4:181766529-181766551 GTGAGCAGAGTGGAGGTGGCAGG + Intergenic
985588819 5:754500-754522 CTGAGCACGGTGGAGATGCAAGG - Intronic
985603432 5:846628-846650 CTGAGCACGGTGGAGGCGCAAGG - Intronic
985603482 5:846901-846923 CTGAGCACGGTGGAGGCGCAAGG - Intronic
985603501 5:847017-847039 CTGAGCACGGTGGAGATGCAAGG - Intronic
985746396 5:1651341-1651363 ATGAGGAGTTTGGAGGTGGGTGG + Intergenic
986241587 5:5964912-5964934 TTGAGCACCAGGGAGGTGGAAGG - Intergenic
988895369 5:35666668-35666690 ATTGGCACTTTGGAGGTGGGAGG + Intronic
988964715 5:36404399-36404421 AAGAGCACTAGGGAAGTGGAAGG - Intergenic
990504917 5:56434487-56434509 CAGAGCATTGTAGAGGTGGAAGG - Intergenic
992549288 5:77845957-77845979 AAGAGCAAGGTGGAGGTGCAGGG + Intronic
994203483 5:97005587-97005609 ACTATCATTGTGGAGGTGGAGGG + Intronic
995997055 5:118313560-118313582 ATGAGCACTATGTAGATGGAAGG + Intergenic
997405701 5:133644957-133644979 ATGAGAACTGAGGCTGTGGAGGG - Intergenic
997476969 5:134148468-134148490 ATGAGCACTGGGGAGCAGGCTGG - Intronic
997736862 5:136219358-136219380 ATGAGCACTGCAGATGTGCAGGG + Intronic
999639338 5:153655952-153655974 ATGTGAACTGAGTAGGTGGAAGG + Intronic
1001055936 5:168449932-168449954 ATGAGGACTGCGGCTGTGGAGGG - Intronic
1001773818 5:174314200-174314222 CTGAGCACTGAGGAGGGGAAAGG - Intergenic
1002341165 5:178517381-178517403 ACGGGCACTGTGGAGGGAGAGGG + Intronic
1002823072 6:746850-746872 TTGAACATTGTGTAGGTGGAGGG - Intergenic
1003878941 6:10463022-10463044 ATGAGCAATGTGGAGGTCATCGG + Intergenic
1005340513 6:24839538-24839560 TTGATCACTGAGGAGGTTGAGGG + Intronic
1006373591 6:33659679-33659701 TGGGGCCCTGTGGAGGTGGAGGG - Intronic
1010017566 6:71122472-71122494 ATGGCCACTGTGGAGGATGAAGG + Intergenic
1010656086 6:78513649-78513671 ATGAGAATTGTGGTGCTGGAAGG - Intergenic
1011756402 6:90502509-90502531 ATGACAAATGTGGAGGTGGTTGG - Intergenic
1012262092 6:97099558-97099580 GAGAGGACTGTGGAGGAGGAAGG - Intronic
1014035147 6:116758280-116758302 GGGAGGACTGTGGAGGTGTAAGG + Intronic
1016154504 6:140786976-140786998 GTGAGCATTGGGGATGTGGATGG - Intergenic
1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG + Intergenic
1017024881 6:150172947-150172969 AGCAGCAGTTTGGAGGTGGATGG - Intronic
1017194367 6:151684222-151684244 ATGAACACTGAGGAAGTGGTGGG + Intronic
1018766414 6:166936711-166936733 ATCACCAGTGTGGAGGTGGGAGG - Intronic
1018799775 6:167212921-167212943 ATAAGCCCTGTGGTGCTGGATGG + Intergenic
1020021323 7:4871241-4871263 CTTAGCACAGTGGAGGTGAAAGG - Intronic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1021000912 7:15329055-15329077 ATAAGCACTTTTGAGGTGCAGGG - Intronic
1022855379 7:34309178-34309200 ATGTGCACTGCGGAGGGGGGCGG + Intergenic
1022983224 7:35624481-35624503 AGGAGCTCTGAGGAGGTGGGTGG + Intergenic
1023230868 7:38027591-38027613 GAGAGCACTGTGGAGCTGCAGGG + Intergenic
1023965470 7:44961443-44961465 CTGAGCACTGAGGGGGTTGAGGG + Intergenic
1026128415 7:67599720-67599742 ATTGGCTCTCTGGAGGTGGAGGG + Intergenic
1026534420 7:71228333-71228355 CTGAGCTGAGTGGAGGTGGACGG - Intronic
1028399622 7:90410696-90410718 ATAAGAATTGTGGGGGTGGAAGG + Intronic
1028525698 7:91783349-91783371 ATGATCCCTGTTGAGGTTGAAGG - Intronic
1028809620 7:95069260-95069282 ATCAGAAATGTGGAGGGGGAGGG + Intronic
1029871451 7:103697263-103697285 ATGAATTCTGGGGAGGTGGAGGG + Intronic
1029943000 7:104500008-104500030 ATGAGCACTGTATATGTGGATGG + Intronic
1030379430 7:108795388-108795410 CTGAACACTGTGGAGGTGCATGG + Intergenic
1030471310 7:109965730-109965752 ATGTCCACTGTTGAAGTGGAAGG + Intergenic
1032983796 7:137315298-137315320 ATGAGGACTGTGGTGTGGGATGG + Intronic
1036561774 8:9904843-9904865 AAGAGCACTGAGGAGGAGAAGGG - Intergenic
1037452765 8:19033601-19033623 ATGAGTACTAGGGAGGTGAAAGG - Intronic
1037636764 8:20707145-20707167 ATAAGCAGTGTGGAGGGGGCAGG + Intergenic
1037829420 8:22179052-22179074 AGGGGCCCTGGGGAGGTGGAGGG + Intronic
1038024765 8:23578529-23578551 ATGAGCAGAGAGGAGGTGGCAGG - Intergenic
1039569814 8:38577772-38577794 TTCAGCACTGGGGAGGTGGCAGG - Intergenic
1039573640 8:38606149-38606171 ATGAGCACTGCAGAAGTAGATGG + Intergenic
1040893053 8:52337600-52337622 ATGAGCAGTGTGAAGGTGTGGGG + Intronic
1044804413 8:95990487-95990509 ATGACCACTGAGGAGGAGGCTGG - Intergenic
1044918508 8:97142725-97142747 ATGAGAACTTTGGAGCTGCATGG - Intronic
1045459844 8:102415928-102415950 AAGAGTAATGTGGAGGTTGAAGG + Intergenic
1046092691 8:109521596-109521618 AGGAGCACTGTGGGGGCAGAAGG + Intronic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1047577178 8:126169416-126169438 ATGAGGAGTGAGGAGGAGGAAGG - Intergenic
1047993151 8:130307647-130307669 ATGATCACTTGAGAGGTGGAAGG - Intronic
1048946818 8:139456362-139456384 ATGAGCATTGTTGAGCAGGACGG + Intergenic
1049494760 8:142924479-142924501 AGGTGCACTGTGGAGGAAGAGGG + Intergenic
1049994844 9:1025139-1025161 GTGAGCATTGTGGAGGAGGCAGG + Intergenic
1051607896 9:18934483-18934505 ATGAAAACTCTGGAGTTGGAAGG - Intronic
1052034889 9:23669382-23669404 CTGAACACTGTGTAGGTGCAGGG + Intergenic
1053575932 9:39357531-39357553 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1053840448 9:42185468-42185490 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1054097501 9:60916222-60916244 GTGAGGACTGTGGGGGTGGGGGG + Intergenic
1054118904 9:61191852-61191874 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1054588848 9:66990710-66990732 GTGAGGACTGTGGGGGTGGGGGG - Intergenic
1055986858 9:82061872-82061894 GTGAGGACTGTGGGGGTGGAGGG - Intergenic
1056419427 9:86409384-86409406 CTCAGCTTTGTGGAGGTGGAAGG + Intergenic
1056584532 9:87919692-87919714 GTGAGGACCGTGGGGGTGGAGGG + Intergenic
1056612334 9:88133228-88133250 GTGAGGACCGTGGGGGTGGAGGG - Intergenic
1058971706 9:110089153-110089175 AAGGGCACTGGGGAGGCGGATGG + Intronic
1059915318 9:119093282-119093304 AGCAGCACTGTGGGGATGGAAGG + Intergenic
1061196790 9:129110951-129110973 TTGAGACCTGTGGAGGAGGAAGG + Intronic
1185686631 X:1934145-1934167 ATGAGCACAGTTGAGGTTGGGGG + Intergenic
1189745716 X:44166967-44166989 AAGAGCACTGTGGTGGAGGATGG - Intronic
1194054572 X:89116373-89116395 ATGATCATTGTGGAAGGGGAAGG + Intergenic
1195368720 X:104151911-104151933 AGGACTACTGTGGAGGTGCAGGG + Intronic
1198303621 X:135356562-135356584 TTGAGCAATGTGGAGGTTAAGGG + Intronic
1199711109 X:150470333-150470355 CTGATCCCTGTGGAGGAGGATGG - Exonic
1200222390 X:154397597-154397619 TTGAGCACAGTGGAGTGGGAAGG + Intronic