ID: 923047205

View in Genome Browser
Species Human (GRCh38)
Location 1:230364102-230364124
Sequence GTGAACAAAGAGATTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923047205_923047208 23 Left 923047205 1:230364102-230364124 CCTTGCTCAATCTCTTTGTTCAC 0: 1
1: 0
2: 1
3: 19
4: 266
Right 923047208 1:230364148-230364170 ACTTGATTCTCAGCTCTATTGGG 0: 1
1: 0
2: 0
3: 18
4: 236
923047205_923047209 24 Left 923047205 1:230364102-230364124 CCTTGCTCAATCTCTTTGTTCAC 0: 1
1: 0
2: 1
3: 19
4: 266
Right 923047209 1:230364149-230364171 CTTGATTCTCAGCTCTATTGGGG 0: 1
1: 0
2: 2
3: 16
4: 174
923047205_923047207 22 Left 923047205 1:230364102-230364124 CCTTGCTCAATCTCTTTGTTCAC 0: 1
1: 0
2: 1
3: 19
4: 266
Right 923047207 1:230364147-230364169 AACTTGATTCTCAGCTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923047205 Original CRISPR GTGAACAAAGAGATTGAGCA AGG (reversed) Intronic
900161724 1:1227222-1227244 GTGAGCAAGGGGATTGGGCAGGG - Intronic
900705840 1:4079653-4079675 GTGAAGAGAGAGATTGTGCAGGG + Intergenic
903432024 1:23311983-23312005 GTGAACAAAGGGCTAGAACATGG - Intronic
905119856 1:35673241-35673263 GTAAAGAAAGAGATTTAGAAGGG - Intergenic
906695689 1:47821806-47821828 GTGTACAAAGAGGGTGACCAGGG - Intronic
909112098 1:71492181-71492203 ATGGACTAAGAGATTGGGCAAGG + Intronic
909954250 1:81758220-81758242 GTGAACATAGAGTTTGAGGATGG + Intronic
911405165 1:97428160-97428182 ATAAACAAAGAGGTTGGGCAAGG - Intronic
912178380 1:107188566-107188588 ATTAATAAAGAGATAGAGCAAGG - Intronic
912643390 1:111368867-111368889 CTGAACCAAGAGGCTGAGCAAGG - Intergenic
915658213 1:157379607-157379629 GGGAACAGAGAGATGGACCAAGG + Intergenic
915670804 1:157487084-157487106 GGGAACAGAGAGATGGACCAAGG - Intergenic
916424155 1:164664777-164664799 GCAAAAAAAGAGATTGGGCAGGG + Intronic
918246888 1:182668481-182668503 GTGAACAAAGACAATTACCAGGG - Intronic
918396078 1:184114309-184114331 GTGAACTAAGTGGTAGAGCAAGG - Intergenic
918607314 1:186443880-186443902 GTGAACACAGAGTATGGGCACGG - Exonic
918672184 1:187231825-187231847 GAGAAAAATGAGATTCAGCAAGG - Intergenic
919759907 1:201091438-201091460 GTGAGCCAAGAAAGTGAGCAGGG - Intronic
921764491 1:218954242-218954264 GGGAGGAAAGACATTGAGCAGGG - Intergenic
922873364 1:228920801-228920823 GTGAAGAAAGAGTTTCAGAATGG - Intergenic
923047205 1:230364102-230364124 GTGAACAAAGAGATTGAGCAAGG - Intronic
923844105 1:237709162-237709184 GTGAATGAAGCGATTGAACAAGG - Intronic
924184397 1:241472323-241472345 GTGATCAAAGCTATTGAGCTTGG - Intergenic
924928090 1:248703015-248703037 GTAAGCAATGAGAATGAGCAAGG - Intergenic
1063076687 10:2723726-2723748 GTGAACAAAGCAATTGAGACTGG + Intergenic
1065323752 10:24532622-24532644 GGCAAGAAAGAGATTGTGCAGGG + Intronic
1065819785 10:29515056-29515078 GAGAAGGAAGAGATTGAGGAAGG - Intronic
1065953131 10:30669833-30669855 GAGAAGGAAGAGATTGAGGAAGG + Intergenic
1067847681 10:49736661-49736683 TTGAACTAAAAGATGGAGCAGGG + Intronic
1067900950 10:50241015-50241037 GTGACCCAAGAGAATGAGCAAGG - Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1070382734 10:75895704-75895726 TTGCACAAAGAAATTGAGTAGGG + Intronic
1070717965 10:78736259-78736281 GGGAACAAAGAGCTTAGGCAAGG - Intergenic
1071156044 10:82690919-82690941 TGGAAGAAAGAGAATGAGCAGGG - Intronic
1071564985 10:86667090-86667112 GTGAAGGAAGTGATTAAGCAGGG + Intergenic
1072145537 10:92632800-92632822 CTGAACAAATAGTTTGTGCATGG - Intronic
1072421429 10:95292817-95292839 GGGAACAAACTCATTGAGCATGG - Intergenic
1072775196 10:98184258-98184280 GTGAGCAAAGAGCTAAAGCATGG - Intronic
1073956437 10:108876850-108876872 GTAAACAAACAGAATGAGCAGGG - Intergenic
1074499320 10:114008728-114008750 TTGAACACAGAGACTGAACAAGG - Intergenic
1074723710 10:116285997-116286019 GAGAAGAAAGAGATTGAACAAGG - Intergenic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1076445581 10:130511744-130511766 GGGAAAGAAGAGATTGAGGAGGG + Intergenic
1077596758 11:3538606-3538628 GTAAAGAGAGAGCTTGAGCAGGG + Intergenic
1078641846 11:13104257-13104279 GTGAACAAAGGAATAGAGGAAGG + Intergenic
1081924784 11:46816291-46816313 ATGTACATAGAGATTGAGAAAGG - Exonic
1083213726 11:61205474-61205496 GGGAACAAAAAGATTGAGAGGGG + Intronic
1084962618 11:72725209-72725231 GTGAACAAAGGGAAGAAGCAGGG - Intronic
1085237578 11:75026790-75026812 GAGAAAACTGAGATTGAGCATGG + Intergenic
1085969438 11:81569080-81569102 GTGAACAACAAGGTGGAGCAGGG - Intergenic
1086509196 11:87538230-87538252 TTGAGCAAAGAAATTGAGGAGGG + Intergenic
1086610842 11:88753877-88753899 AAGAAAAAAGAGCTTGAGCAGGG + Intronic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1087523162 11:99270035-99270057 GTAAATAAAGAGATTAAGAAGGG - Intronic
1087656951 11:100935901-100935923 GTGAACAAATTGCTTGAGCCCGG + Intronic
1088812754 11:113402542-113402564 GAGACTAAAGAGATTGAGCTGGG - Intergenic
1088919542 11:114251186-114251208 GGGAACAAAGAGCTGGAGGAGGG - Intergenic
1091081704 11:132675571-132675593 ATGAATAAAGAAATTTAGCAAGG + Intronic
1091806931 12:3363582-3363604 GTGAACAAAGAGGTTAACAAGGG - Intergenic
1091911240 12:4232272-4232294 GGGAATCATGAGATTGAGCAGGG + Intergenic
1092052618 12:5483055-5483077 GAGAACAAAGAGACAGAGAAAGG - Intronic
1093658030 12:21720185-21720207 GTGAGCAAACTGATTCAGCAAGG - Intronic
1094142425 12:27194934-27194956 GTGAATAAAGAGACTGAGATGGG + Intergenic
1095354516 12:41255812-41255834 GGGAGCAAAGAGAGAGAGCAAGG + Intronic
1095705468 12:45232410-45232432 GTGAAAAAAGAGACTGAACCAGG + Intronic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1097754665 12:63396284-63396306 TTGAACAAAGAGATGAAGCAGGG + Intergenic
1098044774 12:66389080-66389102 GGGAACAGAGAGAATGTGCAGGG + Intronic
1098567870 12:71956185-71956207 GTGATCCAAGAGAGTGAGCAAGG + Intronic
1099328589 12:81252008-81252030 GAGAACAAAAAGAGTGAGAATGG - Intronic
1100563144 12:95769223-95769245 GTAAACAGTGAGATTGAGCTGGG + Intronic
1101244295 12:102870843-102870865 GTGAGCAAAGGGATTGGGCATGG - Intronic
1102571208 12:113828122-113828144 GTGACCAATGGGATGGAGCAGGG + Intronic
1104394627 12:128421870-128421892 GTGAACAGAGAGATGGAAAAAGG - Intronic
1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG + Intergenic
1107548583 13:41455907-41455929 GGGAACAAAGAAATGGAGCATGG - Intergenic
1109174121 13:59134278-59134300 GTAAACAAACAGATTGAATAAGG + Intergenic
1109233727 13:59790439-59790461 ATGAACAAAGAACTTGAGCCTGG - Intronic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1110392331 13:74988950-74988972 GTGAGCAAAGAGATTCTTCAAGG + Intergenic
1110572000 13:77014527-77014549 GGGAGAAAAGAGAATGAGCAAGG + Intronic
1110725670 13:78820077-78820099 ATAAATAAAGAGATTGATCATGG + Intergenic
1112097183 13:96147028-96147050 GTCAGCAAAGTGATTAAGCATGG + Intronic
1112764279 13:102724174-102724196 GTGAACTAAGACAATGAGAAAGG + Intergenic
1114303453 14:21399060-21399082 GTGAACAAACAGTTGGAGGATGG + Intronic
1114762778 14:25335239-25335261 GCAAAGAAAGAGCTTGAGCAGGG + Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1116109080 14:40552112-40552134 GTGATCCAAGAGATAGAGTAAGG - Intergenic
1117180701 14:53188456-53188478 GTGAACAACGAGTTTGGGAAAGG - Intergenic
1117809583 14:59532603-59532625 GTGACCAAGGAGTTTGTGCATGG + Intronic
1117958806 14:61143495-61143517 GTGAAGAGAGAGATTGTGTAGGG + Intergenic
1119197944 14:72731526-72731548 GTGAACACAGGGACTGTGCAGGG - Intronic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1123804668 15:23859028-23859050 TTGAACAGAGAGGTTGCGCATGG + Intergenic
1124223199 15:27867307-27867329 GTGAAAAAAAAGAATTAGCAAGG + Intronic
1126379854 15:48035098-48035120 GTTAACTAAAATATTGAGCATGG + Intergenic
1133452591 16:5916403-5916425 ATGAGCAAAGAGATTGGGAAAGG - Intergenic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1138767410 16:59620982-59621004 GTGAGAAAAGAGATTCAGAAAGG - Intergenic
1139272728 16:65698903-65698925 GTGAAAAAAGAGTGGGAGCAGGG - Intergenic
1139361838 16:66404296-66404318 GTGACCACAGAGGTTGGGCAGGG - Exonic
1139374647 16:66489302-66489324 ATGAACCAAGAGATTGAGGCAGG - Intronic
1141070348 16:80948778-80948800 GTGAAGGAAGAGATTGTGGAAGG + Intergenic
1141236679 16:82224763-82224785 ATGAACAAAGTGATGGAGGAAGG - Intergenic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1144327526 17:14196307-14196329 GTGATCTAAGAGCTTTAGCAGGG + Intronic
1144445779 17:15326755-15326777 CTGAAAAAAGAGATTGGGAAGGG + Intronic
1148702819 17:49600546-49600568 GTTACCAAAGGGAGTGAGCAAGG + Intronic
1148797835 17:50205701-50205723 GGGAAGAAAGAGAAAGAGCAGGG - Intergenic
1149665957 17:58364885-58364907 GAGAACAGAGAGCTGGAGCAAGG - Intronic
1151055095 17:71021657-71021679 GAGAACAAAGAGTTTCAGGAAGG - Intergenic
1151561005 17:74869521-74869543 GTGAACAAAGAGGAAGAGAATGG - Intronic
1155216919 18:23651474-23651496 TTTAACAAAGAGATTGCACAAGG + Intronic
1156518812 18:37704182-37704204 GTGAACATAAAAATAGAGCAGGG + Intergenic
1156974849 18:43207961-43207983 GGGAACGAAGGGATTCAGCAAGG - Intergenic
1158739362 18:60122220-60122242 GTGGACAAAGAAATTAAGCTTGG + Intergenic
1158786735 18:60721746-60721768 GTGAAAAAAGCAAGTGAGCAGGG + Intergenic
1160364421 18:78312351-78312373 GGGAAAAAAGAAATTGAGAAGGG + Intergenic
1160610665 18:80082527-80082549 GAGAACAAACAGATTTAGAAAGG - Intronic
1161904557 19:7146531-7146553 CTTGACAAAGAGGTTGAGCATGG - Intronic
1163444047 19:17336530-17336552 GTAAATAAAAATATTGAGCAGGG + Intronic
1163484991 19:17580265-17580287 GGGAAAAAAGAGATGGAGGAAGG - Intronic
1164239443 19:23371048-23371070 GTGAACTAAGAGGCTGGGCAAGG + Intronic
1164932301 19:32185183-32185205 GGCAAGAAAGAGATTGTGCAGGG + Intergenic
1165718351 19:38061671-38061693 GAGTACAGAGAGATGGAGCAGGG + Intronic
1167998125 19:53423208-53423230 GAGAACAATGATATTGACCAGGG - Intronic
1168007603 19:53503802-53503824 GAGAACAATGATATTGACCAGGG - Intergenic
925613048 2:5719140-5719162 GTGAAGAAGGCGGTTGAGCAAGG + Intergenic
925906165 2:8540705-8540727 GGGAACAAGGAGGTTGAGGAAGG + Intergenic
926103272 2:10134238-10134260 GGGAACAAAGAAAGTGACCATGG + Intergenic
927715287 2:25347966-25347988 GGGAAGAAAGAGAGAGAGCAGGG - Intergenic
928138774 2:28709521-28709543 GGGAACAAAGAGATGGAGGTGGG + Intergenic
928301944 2:30132976-30132998 GTGGACTAGGAGAATGAGCATGG + Intergenic
928713019 2:34028768-34028790 GGAAACAAAGGGATTGTGCAAGG + Intergenic
930848399 2:55931322-55931344 GTAAATAAAGAGATAGGGCAGGG - Intergenic
931835742 2:66096796-66096818 GTGAACAAAAAGATAGAAGAAGG - Intergenic
936753435 2:115675471-115675493 GAGAACAATGAAATTCAGCAAGG + Intronic
938752333 2:134344600-134344622 ATGAGCAAAGAGATTGAGAGAGG + Intronic
938867677 2:135440638-135440660 GTGAACAAAAAGAAGGAGCTTGG + Intronic
939275507 2:139992479-139992501 GGGAGCAAAGAGATTGGGGACGG - Intergenic
939374663 2:141348915-141348937 GTGAAGAGAGAGCTTGTGCAGGG - Intronic
940628441 2:156206968-156206990 ATGATCAAAGAGATGGAGAATGG - Intergenic
941441735 2:165546131-165546153 GTGAAGAAGGGTATTGAGCATGG - Intronic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
942550200 2:177107779-177107801 GTGAACCAAGACTTTGAGAATGG - Intergenic
942869936 2:180722396-180722418 TTTAACAAAGAAATTGAACATGG + Intergenic
942931767 2:181502300-181502322 GTGACCAAAGAAATGGAGCTGGG + Intronic
943022832 2:182596226-182596248 GTGAACACATGGAGTGAGCATGG + Intergenic
943271969 2:185817012-185817034 GTGAAGAAAGGGAAGGAGCAAGG + Intronic
943579790 2:189671900-189671922 GTGATCAAAGAGAGTGAGTCTGG - Intergenic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
946538990 2:220663011-220663033 GGGCACAAAGAGATAGACCAGGG - Intergenic
947651189 2:231787177-231787199 GGGAACAACGAGTTTGAGGACGG - Intronic
948482542 2:238259269-238259291 CTGAGCACAGAGAATGAGCAAGG + Intronic
948911486 2:241006491-241006513 GTGAGTAAATAGATTGAGAATGG + Intronic
1168992249 20:2104421-2104443 GTGAACAAATAACTTGATCAGGG + Intronic
1172572649 20:35982518-35982540 GTGGACAAAGAGATGGAAGAGGG - Intronic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1172879959 20:38193570-38193592 GTGACCATAGAAATTGATCAGGG - Intergenic
1174753892 20:53139381-53139403 TTGAAGAAAGAGACTGGGCAAGG + Intronic
1178932591 21:36832691-36832713 GTGAACAAAGAGTTAGGGAATGG - Intronic
1180128942 21:45812899-45812921 TTGCACAAAGAGAATGAACAGGG - Intronic
1180654140 22:17404678-17404700 GTGAACAATGACATAGAACAGGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183682267 22:39339282-39339304 GTGAACAAAGAAAGAGAGAAAGG - Intergenic
1183798183 22:40138221-40138243 GTGAAATAGGAGATAGAGCAAGG + Intronic
1184977731 22:48074968-48074990 GTGGACAAAGCCAATGAGCAGGG + Intergenic
949363180 3:3253263-3253285 GTGAAAAAAGAGTTTGCACAGGG + Intergenic
949791505 3:7797175-7797197 GGGAGCAAAGAGATCGGGCAGGG + Intergenic
950804052 3:15581538-15581560 GTGTACAAAGACATTGAGACAGG - Intronic
951738434 3:25893800-25893822 GGGAACAAGGAGATTTACCAGGG - Intergenic
952254302 3:31682260-31682282 CTGAACTATGAGATTGAGCCTGG + Intronic
952696360 3:36269005-36269027 GTGAACACAGAGCTTGTCCAAGG - Intergenic
953644362 3:44740365-44740387 GTGAATAAAGAAATTATGCATGG + Intronic
955100907 3:55848788-55848810 AAAAACAAAAAGATTGAGCAAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956402536 3:68895644-68895666 TTGAACACAGAAATAGAGCATGG - Intronic
956932081 3:74054911-74054933 GAGAAGATAGAAATTGAGCAAGG + Intergenic
957608735 3:82439717-82439739 GTGTACAGAGAGATAGAGCAGGG + Intergenic
958518227 3:95149085-95149107 GAGAACAGAGAGATTGATGAGGG - Intergenic
959692710 3:109217035-109217057 GTGTACAAAGACGTTGAACATGG - Intergenic
959742910 3:109741532-109741554 ATGAAAAAAGAGAATGTGCAAGG - Intergenic
960143838 3:114177693-114177715 GTGAGCAAGGGTATTGAGCAAGG - Intronic
960430934 3:117567832-117567854 GTGAAGCAAGATATTCAGCATGG - Intergenic
960480427 3:118181197-118181219 GTGTACAGAGAAATTCAGCATGG + Intergenic
960751621 3:120961211-120961233 GTGAACAAAGAGATGTATCACGG - Intronic
962301081 3:134243639-134243661 GTGAACAAAGACATAGAGGGTGG - Intronic
962336639 3:134537740-134537762 GTGACCATAGGGATGGAGCAAGG - Intronic
965755002 3:172016770-172016792 GTGAACAGAGAGGATGAGGAGGG - Intergenic
966653354 3:182325880-182325902 GAGAATAAAAAGATTGATCATGG + Intergenic
968687737 4:1972786-1972808 GTGAGAAAAGACATTGTGCACGG + Intronic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
971201653 4:24514798-24514820 GTCAACAAGGACACTGAGCAAGG + Intergenic
972371332 4:38426315-38426337 CTCAAGAAAGAGATTGAGCATGG - Intergenic
973036283 4:45411488-45411510 TTGAACAAAATGATTAAGCAAGG - Intergenic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
975208629 4:71673003-71673025 GTGAAGGACAAGATTGAGCAGGG - Intergenic
975215015 4:71743063-71743085 TTGAAGAAAAAGATTGATCAAGG + Intronic
975878721 4:78875874-78875896 GTGATCCAAGAGACAGAGCAAGG + Intronic
976439444 4:85056334-85056356 GTGAAGAAAGAGGTGGAGAAAGG - Intergenic
976934179 4:90608171-90608193 GTGGATAAGGAGTTTGAGCAGGG + Intronic
977082976 4:92556684-92556706 TTGAACAAAGTGAGTGAGCTTGG - Intronic
979281740 4:118876411-118876433 GTTAACAAAGAAATAAAGCAGGG - Intronic
979372144 4:119901821-119901843 GTGAATAAAGTGATTGAAGAAGG - Intergenic
980256173 4:130383003-130383025 GGCAACAAAGAGAGTGTGCAGGG - Intergenic
983253625 4:165374282-165374304 GTGAACAAATATATTGATTATGG - Intronic
985220039 4:187694859-187694881 TTGAACAAAAAGATTGAGCAAGG + Intergenic
987217796 5:15756167-15756189 GTGAAAAAAAAGTCTGAGCAGGG - Intronic
987731626 5:21780959-21780981 GAAAACAAAGAGAATGAGGATGG + Intronic
988093588 5:26572398-26572420 GTGACCAAAGAGATAGAGCCGGG - Intergenic
988642648 5:33058418-33058440 GTGAAGTAAGAAAATGAGCATGG + Intergenic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
990246381 5:53867388-53867410 GGGAAATCAGAGATTGAGCAAGG - Intergenic
991336913 5:65559097-65559119 ATGAATAAAGATATTGAGGAGGG - Intronic
991473781 5:66998635-66998657 GGGAAAGAAGAGATTGAGGATGG - Intronic
992370678 5:76140806-76140828 GAGGACAAAGAGATCAAGCAGGG - Intronic
992548582 5:77840024-77840046 GTGAACAAGGAGATGTATCACGG + Intronic
992948375 5:81832237-81832259 TAGAACAAAAAGATGGAGCAAGG - Intergenic
993782942 5:92091049-92091071 ATAACCAAAGAGATTGAGAAAGG - Intergenic
996383403 5:122885265-122885287 GGGAACACAGAGAATGAGCTTGG - Intronic
996802950 5:127423696-127423718 ATTAACAAAGAGTCTGAGCAGGG - Intronic
999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG + Intergenic
999753338 5:154646614-154646636 AGGAACCAAAAGATTGAGCAAGG - Intergenic
1003905668 6:10697444-10697466 ATGAAAAAGAAGATTGAGCATGG + Exonic
1004186830 6:13428268-13428290 GAGAACAGAGAAATTCAGCATGG - Intronic
1004718558 6:18243554-18243576 GTGAACAAAGATAAGGAACAGGG - Intronic
1006713801 6:36100270-36100292 GAGAACAAAGAGACTGTACAGGG + Intronic
1007041527 6:38726759-38726781 GTGAGTAAAGAGATGGAACAAGG + Intronic
1008497631 6:52149255-52149277 GTCAAGAAAGAGTTTGAGGATGG + Intergenic
1009033284 6:58086215-58086237 CTCAAAAATGAGATTGAGCAAGG + Intergenic
1009851440 6:69204650-69204672 ATGAACAAAGCAACTGAGCAGGG - Intronic
1011369792 6:86623625-86623647 GTGAACAAAGGAATTCAGCAAGG - Intergenic
1011615260 6:89192266-89192288 GTGAACCAAGAGCTGGAGAATGG - Intronic
1014011618 6:116482552-116482574 GAGAAAACAGAGATTTAGCAGGG + Intergenic
1015091503 6:129364234-129364256 GTAAACAAAGAGAAGGAGGACGG - Intronic
1015228622 6:130887371-130887393 GAGAACAATTAGATTGAGCAAGG - Intronic
1016424027 6:143915251-143915273 GAGACCACAGAGATTGTGCAGGG - Intronic
1016424312 6:143917173-143917195 GAGAACAGAGAGCTTGTGCAGGG - Intronic
1016480628 6:144477014-144477036 GTGCAGAAAGAGATTGAGATAGG + Intronic
1017062148 6:150493792-150493814 GTGAAAAGAGAGCTTGTGCAGGG - Intergenic
1017561282 6:155631283-155631305 GGCAAGAAAGAGATTGTGCAGGG + Intergenic
1017897129 6:158690237-158690259 GTGAATAAATAAATTGAGCAGGG + Intronic
1019223083 6:170490362-170490384 GTGACCCAAGAAAGTGAGCAGGG - Intergenic
1019723844 7:2589703-2589725 CTGATTAAAGAGACTGAGCAGGG + Intronic
1021368298 7:19809301-19809323 GTTTACAAAGAAAATGAGCATGG - Intergenic
1022624963 7:32025806-32025828 GTGAACAGAGAAGTGGAGCAGGG - Intronic
1024060985 7:45698588-45698610 GTGAACAAAGATGCTGAGCCGGG + Intronic
1028426652 7:90696906-90696928 GTGAAGAAAGAGTTTCAGGAAGG + Intronic
1028466568 7:91159320-91159342 GTTAACTAAGAGACTCAGCATGG + Intronic
1030453544 7:109744214-109744236 GTTAACAAAGAAAGTGACCATGG - Intergenic
1030915055 7:115302865-115302887 GTAAAGAGAGAGATTGGGCAGGG - Intergenic
1031550397 7:123104651-123104673 CTGAAGAAAGAGTTTTAGCAAGG + Intergenic
1033945470 7:146711017-146711039 CTGAGCCAAGAGGTTGAGCAAGG - Intronic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034760550 7:153668311-153668333 AGGAACAAAGAGATTGAGGGAGG + Intergenic
1035091536 7:156316915-156316937 GTGATCAAAGAAAGGGAGCAGGG - Intergenic
1036252869 8:7177731-7177753 GCAAAGAGAGAGATTGAGCAGGG + Intergenic
1041465158 8:58151025-58151047 GTGACCAAGGAGAGGGAGCAAGG + Intronic
1042995252 8:74691155-74691177 CTGAACAAAGTGATTGAGAAAGG + Intronic
1046170866 8:110503467-110503489 GTGAACCAAGAGATTAAAAATGG - Intergenic
1047026524 8:120830416-120830438 GTGCACAAAGATACTGTGCAAGG + Intergenic
1047028194 8:120847567-120847589 GTGAAGAAAGCGAGAGAGCAGGG - Intergenic
1052545981 9:29880443-29880465 GTGAAGCAAGAGATTGAGATGGG - Intergenic
1052828348 9:33194228-33194250 ATGATCAAACAGATTGGGCACGG + Intergenic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1055326898 9:75139913-75139935 GTGAACAAAGATGTTGTTCAAGG + Intronic
1059749402 9:117233747-117233769 GTGAGCAATGAGACTGACCAAGG + Intronic
1059912128 9:119056237-119056259 GGGAAGAAAGAATTTGAGCAGGG + Intergenic
1060346722 9:122823219-122823241 GTGACCAAGGAGAATGGGCAGGG + Intronic
1060835245 9:126750938-126750960 GTGAACAACCAAATTGAGGAAGG + Intergenic
1061274648 9:129562449-129562471 GTGTGCACAGAGATTGTGCATGG + Intergenic
1061632034 9:131878386-131878408 GTGAGCAAATGGATTGTGCATGG - Intronic
1187912261 X:24121769-24121791 GTGAGTCAGGAGATTGAGCATGG + Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189097245 X:38153632-38153654 ATGAACTAAGAGAGTGAGCAAGG + Intronic
1192030515 X:67507636-67507658 GAGAACAGAGAGAGAGAGCAGGG + Intergenic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192296191 X:69851285-69851307 ATGAAGGAAGAAATTGAGCAGGG - Intronic
1193500788 X:82271666-82271688 GTAAACAAAGAAAATGAGGAGGG + Intergenic
1193762633 X:85486762-85486784 ATTAACAAAGATATTCAGCATGG - Intergenic
1193824533 X:86206664-86206686 ATGAGGAAAGAGATTTAGCAAGG - Intronic
1195901223 X:109799658-109799680 AAGAACAAAGAAAGTGAGCAAGG + Intergenic
1198054973 X:132984927-132984949 GTGAGCAAGGAGAGGGAGCAAGG - Intergenic
1199855158 X:151753687-151753709 GCGAAGAAAGAATTTGAGCAGGG + Intergenic