ID: 923051092

View in Genome Browser
Species Human (GRCh38)
Location 1:230392125-230392147
Sequence TGCCTTGGTCATGTGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923051087_923051092 20 Left 923051087 1:230392082-230392104 CCAAACGAAAATCCTACTTGCTT 0: 1
1: 0
2: 1
3: 7
4: 123
Right 923051092 1:230392125-230392147 TGCCTTGGTCATGTGTCATGGGG 0: 1
1: 0
2: 2
3: 8
4: 193
923051086_923051092 28 Left 923051086 1:230392074-230392096 CCAGATCTCCAAACGAAAATCCT No data
Right 923051092 1:230392125-230392147 TGCCTTGGTCATGTGTCATGGGG 0: 1
1: 0
2: 2
3: 8
4: 193
923051088_923051092 8 Left 923051088 1:230392094-230392116 CCTACTTGCTTTGATTTTTTTCT 0: 1
1: 0
2: 6
3: 138
4: 2011
Right 923051092 1:230392125-230392147 TGCCTTGGTCATGTGTCATGGGG 0: 1
1: 0
2: 2
3: 8
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923051092 Original CRISPR TGCCTTGGTCATGTGTCATG GGG Intronic
902083087 1:13834633-13834655 TACCTTGGGCATGTGTCGTCAGG - Intergenic
902384772 1:16070152-16070174 TGCCCTGGCCATGTGACCTGAGG + Intronic
906273559 1:44500005-44500027 TGGCTTGGTCCAGGGTCATGTGG - Intronic
909939730 1:81597154-81597176 TGCCTTTGACATCTGTCATTTGG + Intronic
910837341 1:91528918-91528940 TCCCTTGGTCATCTGTCCTAAGG + Intergenic
910892668 1:92033840-92033862 TGCCTTGTTGATGTGTCTTCTGG + Intronic
912517573 1:110225908-110225930 AGCCTTGCTCATGGGTCATCTGG - Intronic
912666793 1:111588283-111588305 GGCCTTTGCCATTTGTCATGTGG + Intronic
914339127 1:146743314-146743336 TGCAGTTATCATGTGTCATGGGG - Intergenic
915200030 1:154220609-154220631 TGCCTGAGTCACGTGTCAGGGGG - Intronic
917451983 1:175154871-175154893 TGCCGTGCTCATGTGACATATGG - Intergenic
918069937 1:181127307-181127329 TGCTTTACCCATGTGTCATGAGG - Intergenic
918303307 1:183223649-183223671 TGCCTTTCACATTTGTCATGTGG - Intronic
919247767 1:195011089-195011111 TGCCCTGGTCAAATGTCATGGGG - Intergenic
923012470 1:230099354-230099376 TGCCATGGTCAGATGTCTTGGGG + Intronic
923051092 1:230392125-230392147 TGCCTTGGTCATGTGTCATGGGG + Intronic
924006303 1:239615425-239615447 TCCTTTGGTCATCTGGCATGGGG + Intronic
1065245446 10:23751490-23751512 TCCCTATGTTATGTGTCATGAGG + Intronic
1066975188 10:42361788-42361810 TGCCTCAGTAATGTGTAATGAGG - Intergenic
1067420382 10:46140283-46140305 TACCTTGGGCACGTGTCATCAGG - Intergenic
1067425639 10:46209236-46209258 TACCTTGGGCACGTGTCATCAGG + Intergenic
1067505726 10:46846766-46846788 TACCTTGGGCACGTGTCATCAGG - Intergenic
1068420363 10:56783551-56783573 TGCCTTGGTCATATATTATATGG + Intergenic
1068487332 10:57677068-57677090 TGCCATTGCCTTGTGTCATGTGG - Intergenic
1069623182 10:69850484-69850506 TGCATTAGACATGTGCCATGGGG - Intronic
1069769660 10:70889360-70889382 TGCCTGGGTCATGTGGTAGGTGG + Intergenic
1069953961 10:72038403-72038425 TACCTTGGGCATGTGTCCTCAGG + Intergenic
1072232495 10:93425320-93425342 TGCCTTGGTCATGCATCTTACGG + Intronic
1074752422 10:116599579-116599601 TGGCTTGGTCATGTCACATCTGG + Intronic
1076168494 10:128301267-128301289 GGCCAGGGTGATGTGTCATGAGG + Intergenic
1076339086 10:129730338-129730360 TGCATTGATAATGTGTCATCTGG + Intronic
1076393431 10:130120891-130120913 CACCTTGGGCATGTGTCATCAGG + Intergenic
1076669352 10:132111195-132111217 TGCCTGGGACATGTTTCCTGTGG - Intronic
1076763380 10:132616728-132616750 TGACATGGCGATGTGTCATGTGG + Intronic
1078080799 11:8203528-8203550 TGCTCTGGTCATGTTTCAGGAGG - Intergenic
1079461102 11:20678681-20678703 TGCCTTGTTACTGTGTCCTGTGG + Intronic
1080101486 11:28465069-28465091 TTCCTTGGCCATGTGTTAAGAGG - Intergenic
1080671429 11:34382859-34382881 TGTCTTGGTCATTTGTGATTGGG + Intergenic
1085488586 11:76891404-76891426 TGCCTTGGTCAGGTGAAAGGAGG - Intronic
1085537393 11:77231028-77231050 TGCCTTGTTCATTTGTCTAGAGG - Intronic
1085987281 11:81802172-81802194 CACCTTGGGCATGTTTCATGAGG - Intergenic
1086905443 11:92413150-92413172 TGCCTTTTTCATATGTCATATGG + Intronic
1090893085 11:130944748-130944770 TGCAGTGGTCATGTGCAATGAGG + Intergenic
1092527767 12:9319648-9319670 TGCCTTGGTTATCTGACAGGAGG - Intergenic
1092727268 12:11498534-11498556 TGCCTTGGTTATCTGACAGGAGG + Intronic
1093522091 12:20062912-20062934 TACTTTGGTCATGTATTATGCGG - Intergenic
1093667898 12:21836111-21836133 TGCCTTTGTAATCTCTCATGTGG + Intronic
1097201720 12:57284521-57284543 TGGCTTAGACATGTGTTATGTGG - Intronic
1097586648 12:61523458-61523480 TGGCTTGGCCAGGTGTGATGTGG - Intergenic
1098162306 12:67657363-67657385 TTGCTTGTTCAGGTGTCATGGGG - Exonic
1099510401 12:83528977-83528999 TGCCATGGTCCTGGGGCATGAGG + Intergenic
1100538545 12:95535805-95535827 TGCCTTGGTCATGATACATAGGG - Intronic
1102510457 12:113411756-113411778 TGCCCTGTTCTTGTGTCATTTGG + Intronic
1104347890 12:128019063-128019085 CACCTTGGGCATGTGTCATCAGG + Intergenic
1104680894 12:130750855-130750877 CACCTTGGGCATGTGTCATCAGG - Intergenic
1109729156 13:66387631-66387653 TGCCTTCGCCTTCTGTCATGAGG + Intronic
1109958150 13:69595559-69595581 TGCATTGATCATGTGGAATGTGG - Intergenic
1110922697 13:81108608-81108630 TGCCTTAGGCATGTGTAATCAGG - Intergenic
1112702781 13:102030969-102030991 TGCTTAAGTCATGTTTCATGGGG - Intronic
1116230856 14:42215124-42215146 GGCTTAGGTCATGTGCCATGTGG - Intergenic
1117975574 14:61293277-61293299 TGCCATGGTCATTTGAGATGAGG - Intronic
1118461103 14:65987865-65987887 TGACTTGGTCCTGTCTCAAGTGG + Intronic
1120368747 14:83605606-83605628 GGACTGTGTCATGTGTCATGTGG + Intergenic
1121507783 14:94489825-94489847 TTCATTGGTCATGTATCCTGAGG - Intronic
1121981236 14:98456305-98456327 TGCCATGGGCACGTGTGATGTGG + Intergenic
1127674284 15:61226126-61226148 TACCTAGGTAATGTCTCATGAGG + Intronic
1127905450 15:63372820-63372842 TGACATGGGCATGTGTGATGTGG - Intronic
1129181680 15:73881862-73881884 TGCCTGGGTCAGGAGGCATGGGG - Intronic
1129365291 15:75050352-75050374 TCCCTTGGTCATGTGTACTGGGG - Exonic
1129736908 15:77971695-77971717 TGCCTTGTGCATGTGATATGAGG + Intergenic
1129849161 15:78781926-78781948 TGCCTTGTGCATGTGATATGAGG - Intronic
1130207015 15:81886408-81886430 TAACTGGATCATGTGTCATGTGG - Intergenic
1131607220 15:93919250-93919272 TGCCTTGGGCACATGTCATCAGG + Intergenic
1131660039 15:94504827-94504849 TGCCTTGGTCATTGCTTATGAGG - Intergenic
1137927199 16:52551346-52551368 TGCACTGGTAATGTGTCATCAGG - Intergenic
1138815801 16:60201330-60201352 TGCCTTGGGCACATGTCATCAGG + Intergenic
1139219086 16:65160705-65160727 TGCTTTAGTTATGTGTCAAGTGG - Intergenic
1139370085 16:66461664-66461686 TGCCATGGCCAGGGGTCATGGGG + Intronic
1139995151 16:70974038-70974060 TGCAGTTATCATGTGTCATGGGG + Intronic
1140046681 16:71444162-71444184 TGCGTTGGCTATGTGTGATGGGG + Intergenic
1141046195 16:80718109-80718131 TGCCTTGGTCATGTGGCCTTTGG - Intronic
1143849313 17:9797902-9797924 TGTCTCGCTCTTGTGTCATGTGG + Intronic
1145145653 17:20477252-20477274 TCTCTTGGTCATGTGTCATGAGG - Intergenic
1145763699 17:27443488-27443510 TCTCTTGGTCATGTGTCATGAGG + Intergenic
1146106259 17:30039907-30039929 TGCTTTTGTCATTTGGCATGAGG - Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146398035 17:32484266-32484288 TGCCTTGGGCAAGTGTGAGGAGG + Intergenic
1149633795 17:58149595-58149617 TGCCTTGGTATTTTTTCATGAGG - Intergenic
1152198089 17:78929285-78929307 TGCCCTGGGCATGGGGCATGCGG - Intergenic
1152696910 17:81802228-81802250 TGCCTAAGTCAAGTGCCATGGGG - Intergenic
1154253371 18:12762855-12762877 TGCCTTGGGCACATGTCATCAGG + Intergenic
1159241266 18:65746753-65746775 TGGCATGGTCATGAGTGATGCGG + Intergenic
1162545555 19:11326977-11326999 TACCTTGGTGATGTGGCAGGTGG - Exonic
1163929317 19:20373930-20373952 TGCTTTTGTCATTTGGCATGAGG - Intergenic
1164220647 19:23190543-23190565 TGCCTGGGTCAGGTAGCATGAGG + Intergenic
1165534240 19:36429898-36429920 CACCTTGGGCATGTGTCATCAGG + Intergenic
1167503511 19:49860075-49860097 TGCCCTGGTCATGGGGGATGAGG - Exonic
924981221 2:223317-223339 TGCCTTGGTAATGTGACATTGGG - Intronic
925644387 2:6021007-6021029 TGCCTTGGCCATGTAAGATGTGG + Intergenic
926341055 2:11904561-11904583 AGCCTTGCTCATGTCTCATGGGG + Intergenic
926817816 2:16817630-16817652 TGACTTGGTCAAATGTCATGTGG + Intergenic
927101733 2:19792834-19792856 GGGATTGGTTATGTGTCATGGGG - Intergenic
928363707 2:30685805-30685827 TTCCCTGGTCATCTGTCCTGGGG + Intergenic
928781279 2:34824330-34824352 TTCCTTGATCCTGTTTCATGTGG + Intergenic
930167766 2:48220087-48220109 TGCCTTGGCAATGTGTGATCTGG - Intergenic
930233791 2:48869949-48869971 TGCCTTGGTCATAGTTTATGGGG - Intergenic
930289293 2:49473018-49473040 TGCCTGGGTAAAGAGTCATGAGG + Intergenic
933196386 2:79394833-79394855 TGCCTTGTTTATGGGTCCTGAGG + Intronic
934146199 2:89096576-89096598 TGCCTTCCTCATGTTGCATGAGG + Intergenic
934223066 2:90103999-90104021 TGCCTTCCTCATGTTGCATGAGG - Intergenic
937057246 2:118949417-118949439 TGCTTTTGTCATTTGGCATGAGG + Intronic
940625422 2:156169379-156169401 TGCCTTTGCCATGTGTAAAGAGG - Intergenic
943309316 2:186307208-186307230 CACCTTGGGCATGTGTCATCAGG + Intergenic
944849773 2:203706541-203706563 TGCCTTGATCATGTGCCCTAAGG + Exonic
945762823 2:213935334-213935356 TGCCTTAATAATATGTCATGAGG - Intronic
947918249 2:233848548-233848570 TGCCTTGGCCATGAGGAATGAGG + Intronic
948439601 2:237978298-237978320 TGCCTTGCTCACCTGTGATGTGG + Intronic
948701279 2:239762022-239762044 TGCCTTGTTCACCTGTCCTGGGG - Intergenic
948757078 2:240166145-240166167 TGCCATGATCATGTCTCCTGAGG + Intergenic
1169634531 20:7674019-7674041 AGCCTTGATGATGTTTCATGTGG - Intergenic
1172917052 20:38451051-38451073 AGCCTTGGGTATGTGTCAAGGGG - Intergenic
1174095444 20:48085501-48085523 AACCTTGGGCATGTGTCATCAGG + Intergenic
1174168834 20:48603931-48603953 TGCCCTGGGCATGTGCCCTGTGG + Intergenic
1178837109 21:36108071-36108093 TGCTTTTGTCATTTGGCATGAGG - Intergenic
1179616021 21:42583949-42583971 TGCCCTGGCCATGTGCCCTGTGG + Intergenic
1181570756 22:23766896-23766918 TGGCTAGGTCAGGGGTCATGAGG - Intronic
1182558157 22:31140247-31140269 GGCCTTGGTCAAGTGGCAGGAGG + Exonic
1183930784 22:41235041-41235063 TGGCTTGGTCCTGATTCATGTGG - Intronic
949787815 3:7761059-7761081 TGCCTTGCTCATTTGCCAGGAGG - Intergenic
956654660 3:71537205-71537227 TGCCTTGATCATCTGTCTTTCGG - Intronic
957017661 3:75087530-75087552 TGCCTTTTTTATGTGTCAAGTGG + Intergenic
962444826 3:135455015-135455037 GGGCTCAGTCATGTGTCATGAGG - Intergenic
963745554 3:149121011-149121033 TTTCTTAGTCATGTGTCTTGTGG + Intergenic
969652240 4:8474748-8474770 TGCTTTGGCCATGTTTCACGGGG + Intronic
970553859 4:17212126-17212148 TTCCTTGGGCATATGGCATGCGG - Intergenic
971828712 4:31662278-31662300 TGAACTGCTCATGTGTCATGAGG - Intergenic
973887955 4:55341821-55341843 TGCTTTTGTCATTTGGCATGAGG - Intergenic
975938375 4:79610052-79610074 TGACTTGGTCAAGTGGCATTTGG - Intergenic
976554470 4:86433835-86433857 TGGCTCATTCATGTGTCATGAGG - Intronic
977179464 4:93856715-93856737 TGCCTTGCTCCTGTCTCAGGTGG - Intergenic
977427266 4:96883128-96883150 TGCCTTGTTGCTGTGTCTTGTGG - Intergenic
979314877 4:119250296-119250318 TGGTTTGGTCATGTGTTATCTGG - Intronic
979663314 4:123283693-123283715 TACATTTTTCATGTGTCATGAGG - Intronic
980471847 4:133263099-133263121 TACCTTGGGCATATGTCATCAGG - Intergenic
981155968 4:141435581-141435603 TGGCTTATTTATGTGTCATGAGG + Intergenic
982136234 4:152276760-152276782 GGCCTTGGTTCTTTGTCATGGGG + Intergenic
982636180 4:157899675-157899697 TGCCTGGGACATGTATCATTTGG - Intergenic
984905046 4:184618683-184618705 TACCCTGGGCATGTGTCATCAGG - Intergenic
986834106 5:11615737-11615759 TGCATAGCTCTTGTGTCATGGGG - Intronic
989791170 5:45403431-45403453 TGCCATGGTTATGTTTCCTGAGG - Intronic
991423489 5:66465861-66465883 TACCTTGGGCATGTGTCGTCAGG - Intergenic
994297179 5:98104649-98104671 TGCCTGGCTCATGTGTGATTAGG + Intergenic
994519782 5:100818487-100818509 TGCCTTTGTCATTTGCAATGTGG - Intronic
995151460 5:108851939-108851961 TGACATGGGCATGTGTAATGTGG - Intronic
996101189 5:119447459-119447481 TGCTTTTGTCATTTGGCATGAGG - Intergenic
996532504 5:124541299-124541321 TGCCTTGGAGAGGTGTAATGCGG - Intergenic
996540951 5:124629694-124629716 TGCCCAGGTCCTGTGTCCTGGGG - Intergenic
1003811257 6:9784230-9784252 TGCCTTGGGAATGTGTCAGCTGG + Intronic
1005391137 6:25334382-25334404 TGCCTTGGTGATTTGTCTAGAGG + Intronic
1006838129 6:37011516-37011538 TGCCTTGCTCATCTGTAAAGTGG + Intronic
1011449785 6:87480536-87480558 TGCTTTTGTCATTTGGCATGAGG + Intronic
1011660972 6:89593556-89593578 TGCTTTGGTCACATTTCATGGGG + Intronic
1013047063 6:106497158-106497180 TGTCTTGGGCTGGTGTCATGGGG - Intergenic
1013327377 6:109060806-109060828 TCCCTTGGTCATTCGTCTTGTGG - Intronic
1014669171 6:124278975-124278997 TCACTTAGTGATGTGTCATGAGG - Intronic
1015009180 6:128323116-128323138 TTCATTGGTTATCTGTCATGAGG + Intronic
1017971196 6:159314284-159314306 GGCCCTGGTCTTGGGTCATGAGG + Intergenic
1022230212 7:28406840-28406862 TGCCTTCTGCATGTGTCATCTGG - Intronic
1022443294 7:30451107-30451129 GGCCATGGTCATGAGTCCTGGGG + Intronic
1024220187 7:47281098-47281120 TGACTTGGGCATCTGTCCTGTGG - Intronic
1024343370 7:48289122-48289144 TGCCTTGGTGAAGTGTCAGGAGG + Intronic
1026421115 7:70238406-70238428 TGCCCTGTGCATCTGTCATGTGG + Intronic
1031002122 7:116427987-116428009 TGCATTGGCCATTTGTCATGTGG + Intronic
1036428417 8:8667407-8667429 TGCCTTATTCCAGTGTCATGAGG + Intergenic
1037814251 8:22103517-22103539 TGCTTTGGGCATTTGCCATGAGG - Exonic
1039895915 8:41716391-41716413 TGCCTGGGCCAGGTCTCATGGGG + Intronic
1040074616 8:43216544-43216566 TGCCCTGGTCATGGCCCATGAGG + Intergenic
1040074940 8:43219949-43219971 TGCCCTGGTCATGGCCCATGAGG + Intergenic
1040636818 8:49284645-49284667 TGCCCTAGTCATGTCTCCTGGGG - Intergenic
1040997782 8:53419256-53419278 TGCCTTGGGCACATGTCATCAGG - Intergenic
1041182513 8:55263340-55263362 TGCCCTGGTCATGGCCCATGAGG + Intronic
1041325483 8:56659080-56659102 TGCCCTGGTCATGGGTGCTGAGG + Intergenic
1041405741 8:57497387-57497409 TTCCTTGGTCATCTGACAAGTGG + Intergenic
1042408057 8:68428807-68428829 TGCCTTTGTCATGAATCAAGTGG - Intronic
1044362517 8:91304799-91304821 TGTACTGGGCATGTGTCATGTGG + Intronic
1045152179 8:99421099-99421121 TTCCTTAATCATGTGTCTTGTGG + Intronic
1047038442 8:120965612-120965634 TGCCTTGGTCATGTATCTACGGG + Intergenic
1047271804 8:123367524-123367546 TGCCTTGGTCCTGTGCCTGGTGG + Intronic
1048837689 8:138537078-138537100 TGCCTTGGGCATGGGGGATGGGG - Intergenic
1055286156 9:74730305-74730327 TGCCTTGGTTATTGGTCATTTGG - Intronic
1058685943 9:107479742-107479764 TGCATTGGTTTTGTATCATGGGG + Intergenic
1061447817 9:130651206-130651228 TGTCTTGGTCCTGGGTCTTGGGG - Intergenic
1062616496 9:137398946-137398968 TGTCTTGGGGATGTGTCTTGGGG - Intronic
1189735181 X:44062922-44062944 GGCTTTGGGCATGAGTCATGAGG - Intergenic
1192186488 X:68950393-68950415 TGACTTGTTCCTGTGTCCTGAGG + Intergenic
1195195160 X:102490221-102490243 TGCCTTGGATATGAGACATGAGG - Intergenic
1198714468 X:139542115-139542137 TGCCTTTTTCATCTGTCAGGTGG - Intronic
1199333352 X:146587892-146587914 CACCTTGGGCATGTGTCATCAGG + Intergenic
1200867690 Y:8062658-8062680 TGCTTAGGTCATGTGGGATGGGG - Intergenic
1200907561 Y:8499924-8499946 TGCCTAGGTCATGTATAAAGAGG + Intergenic
1201483526 Y:14467550-14467572 TGCCTTGTTCAATTGTAATGAGG - Intergenic
1202262541 Y:22984598-22984620 TGCCTAGGTCATGCGTAAAGAGG + Exonic
1202415531 Y:24618339-24618361 TGCCTAGGTCATGCGTAAAGAGG + Exonic
1202455256 Y:25051747-25051769 TGCCTAGGTCATGCGTAAAGAGG - Exonic