ID: 923053116

View in Genome Browser
Species Human (GRCh38)
Location 1:230402729-230402751
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923053116_923053122 -8 Left 923053116 1:230402729-230402751 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 923053122 1:230402744-230402766 TTCCAAAGCACTGGGTTGATAGG 0: 1
1: 1
2: 48
3: 871
4: 7852

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923053116 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr