ID: 923055593

View in Genome Browser
Species Human (GRCh38)
Location 1:230424535-230424557
Sequence AGGCCCAAGGGACCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 8, 3: 23, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923055593_923055600 6 Left 923055593 1:230424535-230424557 CCAGCTGGAGGTCCCTTGGGCCT 0: 1
1: 0
2: 8
3: 23
4: 212
Right 923055600 1:230424564-230424586 CCATGTGCCGTGTTCCTGACCGG 0: 1
1: 0
2: 0
3: 8
4: 89
923055593_923055604 27 Left 923055593 1:230424535-230424557 CCAGCTGGAGGTCCCTTGGGCCT 0: 1
1: 0
2: 8
3: 23
4: 212
Right 923055604 1:230424585-230424607 GGTTGAACAATAATCAGAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923055593 Original CRISPR AGGCCCAAGGGACCTCCAGC TGG (reversed) Intronic
900143397 1:1147655-1147677 GGGCACAAGGGCCCTCCTGCCGG + Intergenic
900289434 1:1917669-1917691 AGGCCCAAGGGGCCTCTTCCAGG + Exonic
900462850 1:2809710-2809732 TGGCCCAAGGCTCCGCCAGCAGG + Intergenic
900539578 1:3196144-3196166 AGGCACAGGTGAGCTCCAGCAGG + Intronic
900923296 1:5687477-5687499 AGGACCAAGGGAGCTGCTGCCGG + Intergenic
900998381 1:6134969-6134991 AGACCCAAGGGACCCCCAAGAGG + Intronic
901269765 1:7942634-7942656 AGGGCCAAGGGAAGTCCCGCGGG - Intronic
901939690 1:12652467-12652489 AGGCCAGTGGCACCTCCAGCTGG + Intronic
903461692 1:23525076-23525098 AGGCCCTGGGGCCCTCAAGCTGG - Intronic
904172576 1:28601827-28601849 AACACCAAGGGGCCTCCAGCTGG - Intronic
904375623 1:30080491-30080513 AGGGCCAAGGGTGCCCCAGCCGG - Intergenic
904860272 1:33532703-33532725 AACCCCAAGGGACCTACAGGCGG + Intronic
905337042 1:37251948-37251970 AGGCTAAAGGGACCTCCAGGAGG - Intergenic
906196565 1:43933822-43933844 GGGCCCGAGGGACCTGCTGCTGG - Exonic
906240529 1:44239640-44239662 GGGCCCAAGGAACCTCCTGGGGG + Intronic
906531613 1:46526957-46526979 AGGCTCAAGGCGGCTCCAGCAGG - Intergenic
907276883 1:53321669-53321691 AGGCCCAAGGGACTCACACCGGG + Intronic
907296607 1:53459840-53459862 CGGCCCGAGAGCCCTCCAGCCGG + Exonic
913278438 1:117162064-117162086 ATGCCCTAGGGACCTGCTGCAGG + Intronic
913685943 1:121232126-121232148 TGGCCCAAAGGGCCTGCAGCTGG - Intronic
914037794 1:144019729-144019751 TGGCCCAAAGGGCCTGCAGCTGG - Intergenic
914151659 1:145048203-145048225 TGGCCCAAAGGGCCTGCAGCTGG + Intronic
915255140 1:154622626-154622648 AGGCCCAAGGAGCCTCCAGCTGG - Intronic
915600398 1:156920051-156920073 AGTCCCCAGAGACCTCCAGGAGG + Intergenic
915937364 1:160097383-160097405 AGGGCCCAGGGACCTGCAGCAGG + Intronic
915963217 1:160284194-160284216 AGGCCAAAGGGAGCTCTAGAAGG - Intronic
920369509 1:205469249-205469271 AGGTCCAAGGCACCTCCTGCTGG + Intergenic
920473266 1:206250683-206250705 TGGCCCAAAGGGCCTGCAGCTGG - Intronic
920531002 1:206702486-206702508 CAGCCCAAGGGCCATCCAGCCGG + Intronic
920876085 1:209837203-209837225 AGGCCCAAGGTGAGTCCAGCAGG + Exonic
921361855 1:214337392-214337414 TGACCCAAGTGCCCTCCAGCAGG + Intergenic
922541937 1:226426606-226426628 ACGCCCACCGGAACTCCAGCTGG + Intergenic
923055593 1:230424535-230424557 AGGCCCAAGGGACCTCCAGCTGG - Intronic
1062879950 10:969986-970008 AGCACCCAGGGACCTCCTGCAGG - Intergenic
1069721314 10:70551307-70551329 AGTCCCAGGTGGCCTCCAGCAGG + Intronic
1069734944 10:70647969-70647991 AGGCCCCAGGGAACTCCAGCTGG - Intergenic
1069893092 10:71664142-71664164 AGGCCCCAGAGACCACCAGGTGG + Intronic
1071163880 10:82782383-82782405 AAGGCCAAGGGACCTGCATCTGG - Intronic
1072634220 10:97166986-97167008 AGGCCCACGGGACAGACAGCGGG - Intronic
1073112723 10:101072184-101072206 AGGCTCAAGGGACCTGGGGCGGG + Intergenic
1074226921 10:111493879-111493901 AGGCCCAAGGGCTCTTCAGTTGG + Intergenic
1074981954 10:118627006-118627028 GGGCCCCATTGACCTCCAGCTGG - Intergenic
1076368611 10:129937392-129937414 AGGCCCCAGGGACCTCAGGTGGG + Intronic
1076883600 10:133251543-133251565 AGGGCCGAGGGACCACCCGCAGG + Intergenic
1077083064 11:734079-734101 AGGCCCAGGGGTCCTCCTCCCGG - Intergenic
1077135274 11:994979-995001 AGGCCAGAGGGGCGTCCAGCAGG - Intronic
1077334730 11:1998199-1998221 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1077899950 11:6480056-6480078 TGGCCTATAGGACCTCCAGCAGG - Exonic
1078319214 11:10318722-10318744 AGGCCCAAGAGAGGTCCAGCTGG + Intronic
1079711291 11:23685423-23685445 AGGGGAAAGGGACCTCCAGTGGG + Intergenic
1082908048 11:58334172-58334194 AAGCCCAAAGGACCTCAAACAGG - Intergenic
1083870761 11:65487070-65487092 AAGCCCCTGGGACCTTCAGCAGG - Intergenic
1084219488 11:67668362-67668384 GGGCCCAAGGGAACCCCAGTGGG + Intronic
1084883942 11:72191159-72191181 AGGCCCCAGGGCTGTCCAGCTGG + Intronic
1085150436 11:74248397-74248419 AGGCCCATGAGATATCCAGCAGG - Intronic
1087201296 11:95347045-95347067 GGGCCCAAGGGCTCTTCAGCTGG - Intergenic
1088535889 11:110860532-110860554 AGACCCAAGGAACCTTCAGGGGG + Intergenic
1090012882 11:123061302-123061324 ATGTCCAAGGGACCTGCAGTTGG - Exonic
1090598167 11:128341927-128341949 AGGCTCCTGGGTCCTCCAGCAGG + Intergenic
1202817713 11_KI270721v1_random:53381-53403 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1091394268 12:143956-143978 AAGAGCAAGGGGCCTCCAGCCGG + Intronic
1091405335 12:205236-205258 AGGCCTAACAGACATCCAGCAGG + Intronic
1092930701 12:13312750-13312772 AGGCCAGAGGCACCTGCAGCTGG - Intergenic
1095963490 12:47850880-47850902 ATTCCCACGGTACCTCCAGCAGG + Intronic
1101898369 12:108772351-108772373 AGGCCCCTGGGGCCTTCAGCAGG + Intergenic
1102260473 12:111440201-111440223 AGGCTCAAGAGACCTCCAAGGGG - Intronic
1104784952 12:131443435-131443457 AGACCCCAGGGCCCTCCAGGTGG + Intergenic
1106776572 13:33015940-33015962 AGGCCCAAAGAAGCTCCGGCTGG - Intergenic
1110229443 13:73153141-73153163 AGGCCCATTGGGCCCCCAGCTGG + Intergenic
1110874395 13:80490877-80490899 ACGCCCACCGGAACTCCAGCTGG + Intergenic
1113415174 13:110123429-110123451 AGGACCCAGGGACCTCGGGCTGG + Intergenic
1116106526 14:40514523-40514545 AGGCCCAAGGGCTCTACAACCGG - Intergenic
1119780347 14:77272853-77272875 AGGTCCACGGGACCCCAAGCTGG - Intergenic
1121409098 14:93737189-93737211 AAGCCGAAGGGAACCCCAGCTGG - Intronic
1121456461 14:94041799-94041821 GGGCCCAAGGAACCCACAGCCGG - Intronic
1122838929 14:104445186-104445208 AGCCCACAGGGACCTCCTGCTGG - Intergenic
1122931460 14:104934521-104934543 TGGCCCCATGGACCTCCACCAGG - Exonic
1123118537 14:105905744-105905766 AGGCCCCAGGAACTGCCAGCAGG + Intergenic
1124641942 15:31401355-31401377 AGGCCCAAGGGACCCTGGGCAGG - Intronic
1124658242 15:31525536-31525558 AGGCTCATGGGCCCTGCAGCGGG - Intronic
1124899304 15:33807678-33807700 AGGCCTGGGGGACCTCCAGGCGG - Intronic
1125768585 15:42150757-42150779 AGGCTCTAGGCAGCTCCAGCTGG - Exonic
1125937436 15:43648999-43649021 TGGCCCAGGGGACCTGCAGCCGG - Intronic
1126850936 15:52796377-52796399 AGGGCCAAGAGACCTCGAGGTGG + Intergenic
1127779572 15:62299383-62299405 AGAACCAATGGACCTCCAGATGG + Intergenic
1129038107 15:72663183-72663205 AGGCCAAAGGCAGCTCCAGCTGG + Intronic
1129211783 15:74074048-74074070 AGGCCAAAGGCAGCTCCAGCTGG - Intronic
1129398620 15:75267036-75267058 AGGCCAAAGGCAGCTCCAGCTGG + Intronic
1129402228 15:75291312-75291334 AGGCCAAAGGCAGCTCCAGCTGG + Intronic
1129475772 15:75783769-75783791 AGGCCAAAGGCAGCTCCAGCTGG + Intergenic
1129728906 15:77918320-77918342 AGGCCAAAGGCAGCTCCAGCTGG - Intergenic
1129839605 15:78735541-78735563 AGGCCAAAGGCAGCTCCAGCTGG + Intergenic
1132763075 16:1520393-1520415 AAGCACAAGGGACCCCGAGCAGG + Intronic
1132870738 16:2114733-2114755 AGGCCCAAGTGCCCTCCAGCTGG + Exonic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133268714 16:4600209-4600231 ATCCCTAAGGGACCCCCAGCAGG + Exonic
1133878901 16:9762451-9762473 AGGCCCGAGGGACCCTCAGGTGG - Exonic
1134521791 16:14922171-14922193 AGGCCCAAGTGCCCTCCAGCTGG - Intronic
1134709461 16:16320822-16320844 AGGCCCAAGTGCCCTCCAGCTGG - Intergenic
1134716674 16:16360851-16360873 AGGCCCAAGTGCCCTCCAGCTGG - Intergenic
1134950142 16:18347823-18347845 AGGCCCAAGTGCCCTCCAGCTGG + Intergenic
1134958076 16:18391308-18391330 AGGCCCAAGTGCCCTCCAGCTGG + Intergenic
1137365464 16:47855816-47855838 GGGCCCTAGGGACCTCCAAGTGG - Intergenic
1138292916 16:55863226-55863248 ATGCCCAAGGCACCTCATGCTGG - Intronic
1139018784 16:62723160-62723182 AGACCCGAGGGACCTACACCTGG + Intergenic
1141716178 16:85728419-85728441 AGCCCCAAGGGACCTTCCCCAGG + Intronic
1142255996 16:89014242-89014264 AGGCCCAAGGGGACTCTGGCTGG + Intergenic
1142398936 16:89849152-89849174 AGGCCAAAGGGCCCCCCTGCAGG + Intronic
1144696334 17:17306269-17306291 AGGTCCCAGAGAGCTCCAGCAGG + Intronic
1144945118 17:18965826-18965848 AGGCCCCAGGGTCAGCCAGCAGG + Intronic
1145238934 17:21228301-21228323 AGGCCCAAGGCAGCTCCTGAGGG - Intergenic
1146197543 17:30825837-30825859 AGGCCCAAGAGATGACCAGCAGG + Intergenic
1147164071 17:38584214-38584236 AGGCCCAACGCCCCTCCACCAGG - Intronic
1148343816 17:46890287-46890309 AGGGACAAGGGCCATCCAGCTGG + Intergenic
1149347270 17:55751256-55751278 AGGCCCCGCGGTCCTCCAGCGGG - Intronic
1151626257 17:75277720-75277742 AGGCCCATGTTGCCTCCAGCTGG - Intronic
1152869193 17:82742915-82742937 TGCCCCAGGTGACCTCCAGCTGG - Intronic
1156327179 18:36085263-36085285 AGGCTCCAGGGAGCTCCCGCTGG - Intergenic
1156361438 18:36387774-36387796 AAGCCCAGGGGACATCCAGAGGG - Intronic
1157721957 18:49932042-49932064 AAGAAGAAGGGACCTCCAGCTGG - Intronic
1157741431 18:50096815-50096837 TGGACCTAGGGAGCTCCAGCAGG - Intronic
1157948369 18:52006539-52006561 GGGCCCAAGGGGCCTTCAGAAGG - Intergenic
1159573256 18:70144330-70144352 AGGCCCACGGGAATACCAGCTGG - Intronic
1160659745 19:292331-292353 AGGCCCAAGGGACCCACACTGGG + Intergenic
1161345656 19:3767656-3767678 AGGCACAGGGGACCTGCAGACGG - Intronic
1161984500 19:7646247-7646269 AGGGCTCGGGGACCTCCAGCCGG + Exonic
1162625490 19:11881376-11881398 GGGTGCAAGGAACCTCCAGCAGG + Intronic
1163230428 19:15998201-15998223 AGGCCCTAGGAATCTCCAGTAGG - Intergenic
926112661 2:10192889-10192911 AGGCCAAAGCTACCTCCTGCTGG - Intronic
926214285 2:10894612-10894634 AGGTGCAAGGATCCTCCAGCTGG - Intergenic
927277722 2:21275724-21275746 TGGCCCCAGGGAGCTCCATCAGG - Intergenic
929572725 2:43032850-43032872 TCGCCCAAGGGTCTTCCAGCTGG - Intergenic
932708875 2:74047670-74047692 GTTCCCACGGGACCTCCAGCTGG - Exonic
932858749 2:75266722-75266744 AGGCCCAAGGGCTCTTCAGTTGG + Intergenic
933722835 2:85409334-85409356 AGGACCATGGGACAGCCAGCAGG - Intronic
934682168 2:96291943-96291965 AGCCCCAGGGCACCTGCAGCAGG + Intronic
935021550 2:99237319-99237341 AGGCCCAAGGGAACCCCTGCTGG + Intronic
935340233 2:102053202-102053224 TGGCGCAAGGGCCCTCCCGCGGG - Intergenic
935794437 2:106627852-106627874 AGGCCAAAGCCAACTCCAGCTGG - Intergenic
937320494 2:120957988-120958010 TGGCCCAAGGGAGGGCCAGCCGG + Intronic
937958977 2:127439914-127439936 AGGCCCCAGGAGCCTTCAGCAGG + Intronic
939172626 2:138713105-138713127 AGTCCCAAGGGGCCTCCTTCTGG + Intronic
940351652 2:152696649-152696671 AGGCCAATGAGACCTCCAGTAGG + Intronic
945993183 2:216413174-216413196 TGGCCAAAGGGAGCCCCAGCAGG + Intronic
946311409 2:218884206-218884228 AGACCCCAAGGTCCTCCAGCAGG - Intronic
946773752 2:223116052-223116074 AGGCTCAGTGGACCTCCAGAAGG + Intronic
1169474844 20:5922425-5922447 AAGCCCACGAGTCCTCCAGCAGG + Exonic
1172313426 20:33935166-33935188 AGGCCCAAGGGGAGTCCGGCAGG + Intergenic
1173873631 20:46356747-46356769 AGGCCCAAGGGCCCCACAGGAGG - Intronic
1175267406 20:57710693-57710715 CTGCCCAAGGGGCCTCCGGCTGG + Intronic
1176375695 21:6085973-6085995 AGGCCCCAGGGGTCTCCTGCAGG + Intergenic
1178790228 21:35693106-35693128 AGGCCCAAGGGTCCTCAGGAGGG - Intronic
1179747779 21:43452271-43452293 AGGCCCCAGGGGTCTCCTGCAGG - Intergenic
1179821598 21:43940296-43940318 AGGCCAAAGCCACCGCCAGCAGG - Intronic
1180174042 21:46078923-46078945 AGGCACAAGGGTCCCACAGCAGG + Intergenic
1181679089 22:24478959-24478981 ATGCCCCTGGGACCTCCAGAAGG - Intergenic
1183450852 22:37894128-37894150 AGGCCCTGGGCACCTCCACCTGG - Intergenic
1184515052 22:44956713-44956735 AGGCCCAGGGGACCTCTTGCTGG + Intronic
1184935609 22:47718261-47718283 AGGCACAATGGAACTGCAGCGGG - Intergenic
949241935 3:1883644-1883666 AGGGCTAAGTGAGCTCCAGCAGG - Intergenic
950261934 3:11548772-11548794 AGGCCCAAGAGGCCCTCAGCGGG - Intronic
953665363 3:44922310-44922332 AGAACCAAGGGACCTCCAGATGG - Intronic
954795610 3:53160121-53160143 AGGCTCAAGGGGGCTCCTGCGGG - Intronic
954860414 3:53683927-53683949 AGGCCCAACAAACCTCAAGCAGG + Intronic
957781050 3:84818066-84818088 AAGCCAAAGGGACCTGCATCAGG + Intergenic
963827305 3:149970268-149970290 AGAGCCTAGGGACCTCCACCCGG + Intronic
968646754 4:1744874-1744896 AGGCCCAAGGGCCTTCTAGAAGG - Intronic
968651240 4:1761100-1761122 GGGCCCACCTGACCTCCAGCCGG + Intergenic
969161221 4:5260804-5260826 AGGCCCTAGGGACCAACATCTGG + Intronic
970383390 4:15531219-15531241 AGCCCCTGGGGACCTCCACCTGG + Intronic
976045377 4:80940405-80940427 AGGGCCAAGGGAGATCCCGCAGG - Intronic
978476456 4:109136732-109136754 AGGCCTCAGTGACCCCCAGCTGG + Intronic
985762892 5:1760761-1760783 AGGACTCAGGGGCCTCCAGCGGG - Intergenic
987234491 5:15929053-15929075 AGGCTCCAGGGACCAACAGCAGG - Intronic
987476725 5:18399986-18400008 ACGCCCACCGGAACTCCAGCTGG + Intergenic
992180843 5:74196987-74197009 ATACCCAAGGGGGCTCCAGCAGG - Intergenic
992393708 5:76352583-76352605 AGGTCCAAGGGACCAGCATCTGG - Intronic
996899946 5:128533269-128533291 AGACCCAAAGTACCTCCACCCGG + Intronic
998847789 5:146327616-146327638 AGGGCCCAGGGATCACCAGCAGG - Intronic
999270677 5:150294803-150294825 TGGCCCAAGTTTCCTCCAGCCGG - Intergenic
1001416114 5:171545699-171545721 GGGACCATGGGCCCTCCAGCTGG + Intergenic
1008588494 6:52970314-52970336 AGGCCCAAGGGATCTCCCCAAGG - Intergenic
1016728829 6:147406531-147406553 ATGTCGAAGGGACCTGCAGCTGG + Intergenic
1017907146 6:158764687-158764709 AGGTCAAAGGGGTCTCCAGCTGG - Exonic
1019292894 7:258912-258934 AGGCCCGAGGGGGCTCGAGCTGG - Intronic
1019308695 7:348387-348409 AGCAACAAGGGACCCCCAGCAGG - Intergenic
1019518751 7:1451198-1451220 AGCCCCACGTGACCTCCAGCTGG + Intronic
1019644469 7:2121630-2121652 GGGCCCAAGCGGCCTCCTGCTGG - Intronic
1019927993 7:4205928-4205950 GGTCCCACGTGACCTCCAGCTGG - Exonic
1020342786 7:7130899-7130921 AGCCCCAAGGAATCTCAAGCTGG - Intergenic
1020615193 7:10451313-10451335 ATGTCCAAGGGACCTGCAGTTGG + Intergenic
1021335124 7:19390947-19390969 AAGCTAAAGGGACCTGCAGCAGG + Intergenic
1022189365 7:28002223-28002245 AGGCCCAGTGGAATTCCAGCAGG + Intronic
1022594278 7:31697176-31697198 AGGCCCTGGGGACCTCCAGATGG - Intronic
1025837321 7:65106380-65106402 TGGCCCAAAGGGCCTGCAGCTGG - Intergenic
1025907099 7:65795905-65795927 CGGCCCAAAGGGCCTGCAGCTGG - Intergenic
1026040189 7:66861749-66861771 TGGCCCAAAGGGCCTGCAGCTGG - Intergenic
1029206203 7:98870433-98870455 AGCCCCAAGGGACCTGCAGGCGG - Intronic
1030287817 7:107844656-107844678 AGAAGCAAGGGACCTTCAGCTGG + Intergenic
1030819342 7:114077156-114077178 AGGCCCACCGGAACTCCAGCTGG + Intergenic
1032451569 7:132036192-132036214 AGGTCCTAGGGGACTCCAGCTGG - Intergenic
1034962207 7:155369958-155369980 AGGCCACAGCGACCTACAGCAGG + Intergenic
1035578853 8:727518-727540 AGGGCCAAGGGGTCTGCAGCAGG - Intronic
1036286705 8:7449132-7449154 AGGACCAAGGGGTCTCCACCAGG - Intronic
1036334773 8:7862391-7862413 AGGACCAAGGGGTCTCCACCAGG + Intronic
1036587131 8:10134538-10134560 TGGCCGAAGGGTCCTGCAGCAGG - Intronic
1037742186 8:21616620-21616642 ATGCCCCAGTGACCTCTAGCTGG - Intergenic
1038024732 8:23578223-23578245 AGATCCAAGAGATCTCCAGCAGG - Intergenic
1038036478 8:23690911-23690933 TGGCCCAAGGGATCACCAGGGGG + Intergenic
1038610246 8:29054308-29054330 AGGCCCCAGGGGACTCCCGCAGG + Intronic
1042241151 8:66666099-66666121 AGGCCCAAGGGAACACCCTCAGG + Exonic
1042742896 8:72070855-72070877 AGGCCCAGGGGACATCCAGTTGG - Intronic
1042758643 8:72246651-72246673 AGGCCCAGGGGACATCCACTTGG - Intergenic
1046337326 8:112807170-112807192 AGTCACAAGGGTCCTCCAGCTGG - Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049409456 8:142465977-142465999 AGGCCCACGGGGCCTCCACAGGG - Intronic
1053530785 9:38879014-38879036 AGGCCCCAGGTACCTCCTGGGGG + Intergenic
1054203008 9:62103447-62103469 AGGCCCCAGGTACCTCCTGGGGG + Intergenic
1054635355 9:67484918-67484940 AGGCCCCAGGTACCTCCTGGGGG - Intergenic
1056338913 9:85604088-85604110 AGGCCCAAGGGCTTTCCAGCCGG - Intronic
1056638477 9:88350334-88350356 AGCCTCAAGGGACCTGGAGCAGG - Intergenic
1058978692 9:110149054-110149076 ATGCCCAAGGGAAATCCATCCGG + Intronic
1060405371 9:123370413-123370435 AGACCCAGGGGGCCACCAGCTGG - Exonic
1060539485 9:124419935-124419957 AGGCCCAGGGGAGGGCCAGCTGG - Intergenic
1060763509 9:126275806-126275828 AGGCCCGAGGGGCTTCCCGCAGG - Intergenic
1061226495 9:129283751-129283773 AGGCCCCAGGGGCCTCTCGCAGG - Intergenic
1061570994 9:131477387-131477409 TGCCCCAAGGGCCCTCCGGCAGG + Intronic
1061872551 9:133528546-133528568 AGGCCCCAGTGGGCTCCAGCGGG + Intronic
1062548848 9:137077003-137077025 AGGCCCCAGGGACGCCCCGCAGG - Intergenic
1188772544 X:34171369-34171391 AAGCCCAAGGTGACTCCAGCAGG - Intergenic
1190176889 X:48157877-48157899 AGGACCAAAGGTCCTGCAGCTGG + Intergenic
1192330978 X:70175092-70175114 TGGCTCAAGAGAGCTCCAGCTGG + Intergenic
1192944492 X:75950285-75950307 AGGCCAAAGGGAGCTCCCTCTGG - Intergenic
1193169038 X:78315221-78315243 AGGCCCAAGGGCTCTTCAGTTGG - Intronic
1193232573 X:79065805-79065827 AGGCCCCAGGGAGGTCCAGGAGG + Intergenic
1196233725 X:113255275-113255297 AGGCCCAAGGGCCCTTCAGTTGG + Intergenic
1196757344 X:119169588-119169610 ATGCCCATGGGACATCCAGGTGG - Intergenic
1196862270 X:120039543-120039565 AGACCCAAGAGACCACCAGGAGG + Intergenic
1196880832 X:120196801-120196823 AGACCCAAGAGACCACCAGGAGG - Intergenic
1197053943 X:122094437-122094459 AGGCCCAAGGGCTCTTCAGTTGG - Intergenic
1198132107 X:133705979-133706001 AGGGTCAAGGGACATCCTGCAGG - Intronic
1198996189 X:142577069-142577091 AGGCCCAAGGGCTCTTCAGTTGG + Intergenic
1199728055 X:150604440-150604462 AAACTCAAGGGATCTCCAGCAGG - Intronic
1199971615 X:152865887-152865909 CGGCCCAAGGGACCCGCAGTTGG + Exonic