ID: 923055880 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:230425877-230425899 |
Sequence | GAGGGCGCCGGCGCTGCTCG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 198 | |||
Summary | {0: 1, 1: 1, 2: 0, 3: 19, 4: 177} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
923055880_923055886 | 2 | Left | 923055880 | 1:230425877-230425899 | CCTCGAGCAGCGCCGGCGCCCTC | 0: 1 1: 1 2: 0 3: 19 4: 177 |
||
Right | 923055886 | 1:230425902-230425924 | CCGCGCGCCCCCGCCGCCCTCGG | 0: 1 1: 0 2: 8 3: 59 4: 408 |
||||
923055880_923055887 | 8 | Left | 923055880 | 1:230425877-230425899 | CCTCGAGCAGCGCCGGCGCCCTC | 0: 1 1: 1 2: 0 3: 19 4: 177 |
||
Right | 923055887 | 1:230425908-230425930 | GCCCCCGCCGCCCTCGGCCATGG | 0: 1 1: 1 2: 4 3: 43 4: 351 |
||||
923055880_923055892 | 14 | Left | 923055880 | 1:230425877-230425899 | CCTCGAGCAGCGCCGGCGCCCTC | 0: 1 1: 1 2: 0 3: 19 4: 177 |
||
Right | 923055892 | 1:230425914-230425936 | GCCGCCCTCGGCCATGGCCCCGG | 0: 1 1: 0 2: 2 3: 27 4: 269 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
923055880 | Original CRISPR | GAGGGCGCCGGCGCTGCTCG AGG (reversed) | Intergenic | ||