ID: 923055880

View in Genome Browser
Species Human (GRCh38)
Location 1:230425877-230425899
Sequence GAGGGCGCCGGCGCTGCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923055880_923055892 14 Left 923055880 1:230425877-230425899 CCTCGAGCAGCGCCGGCGCCCTC No data
Right 923055892 1:230425914-230425936 GCCGCCCTCGGCCATGGCCCCGG No data
923055880_923055887 8 Left 923055880 1:230425877-230425899 CCTCGAGCAGCGCCGGCGCCCTC No data
Right 923055887 1:230425908-230425930 GCCCCCGCCGCCCTCGGCCATGG No data
923055880_923055886 2 Left 923055880 1:230425877-230425899 CCTCGAGCAGCGCCGGCGCCCTC No data
Right 923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923055880 Original CRISPR GAGGGCGCCGGCGCTGCTCG AGG (reversed) Intergenic