ID: 923055881

View in Genome Browser
Species Human (GRCh38)
Location 1:230425889-230425911
Sequence GGGCGCGCGGAGGAGGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923055881_923055892 2 Left 923055881 1:230425889-230425911 CCGGCGCCCTCCTCCGCGCGCCC No data
Right 923055892 1:230425914-230425936 GCCGCCCTCGGCCATGGCCCCGG No data
923055881_923055887 -4 Left 923055881 1:230425889-230425911 CCGGCGCCCTCCTCCGCGCGCCC No data
Right 923055887 1:230425908-230425930 GCCCCCGCCGCCCTCGGCCATGG No data
923055881_923055886 -10 Left 923055881 1:230425889-230425911 CCGGCGCCCTCCTCCGCGCGCCC No data
Right 923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923055881 Original CRISPR GGGCGCGCGGAGGAGGGCGC CGG (reversed) Intergenic