ID: 923055882 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:230425895-230425917 |
| Sequence | CGGCGGGGGCGCGCGGAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 612 | |||
| Summary | {0: 1, 1: 1, 2: 15, 3: 76, 4: 519} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 923055882_923055892 | -4 | Left | 923055882 | 1:230425895-230425917 | CCCTCCTCCGCGCGCCCCCGCCG | 0: 1 1: 1 2: 15 3: 76 4: 519 |
||
| Right | 923055892 | 1:230425914-230425936 | GCCGCCCTCGGCCATGGCCCCGG | 0: 1 1: 0 2: 2 3: 27 4: 269 |
||||
| 923055882_923055887 | -10 | Left | 923055882 | 1:230425895-230425917 | CCCTCCTCCGCGCGCCCCCGCCG | 0: 1 1: 1 2: 15 3: 76 4: 519 |
||
| Right | 923055887 | 1:230425908-230425930 | GCCCCCGCCGCCCTCGGCCATGG | 0: 1 1: 1 2: 4 3: 43 4: 351 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 923055882 | Original CRISPR | CGGCGGGGGCGCGCGGAGGA GGG (reversed) | Intergenic | ||