ID: 923055886

View in Genome Browser
Species Human (GRCh38)
Location 1:230425902-230425924
Sequence CCGCGCGCCCCCGCCGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 8, 3: 59, 4: 408}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923055881_923055886 -10 Left 923055881 1:230425889-230425911 CCGGCGCCCTCCTCCGCGCGCCC 0: 1
1: 1
2: 8
3: 88
4: 812
Right 923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG 0: 1
1: 0
2: 8
3: 59
4: 408
923055880_923055886 2 Left 923055880 1:230425877-230425899 CCTCGAGCAGCGCCGGCGCCCTC 0: 1
1: 1
2: 0
3: 19
4: 177
Right 923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG 0: 1
1: 0
2: 8
3: 59
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923055886 Original CRISPR CCGCGCGCCCCCGCCGCCCT CGG Intergenic
900118749 1:1039815-1039837 CCACACGCCCCCTCCTCCCTGGG - Intronic
900171923 1:1273534-1273556 CCGTTCGCGCCCGCCGCCCGCGG - Intronic
900349650 1:2228461-2228483 CCGCGCGCCCCCCGGGCTCTAGG - Intergenic
900626651 1:3611588-3611610 TCGCCCGCCCCCTGCGCCCTCGG + Intergenic
901057401 1:6455100-6455122 CCCAGCGCCGCCGCCGCCCACGG + Intronic
901242975 1:7705352-7705374 ACGCGCGCCCCTCACGCCCTCGG - Intronic
901629026 1:10639249-10639271 CCGCCCGACGCCGCCGCCCCCGG - Exonic
901659088 1:10787505-10787527 CCGCCCGCCCCCCTCGCCCCCGG - Intronic
901676572 1:10889013-10889035 CCGCCCGCCCCGGCCGCCCAGGG - Intergenic
902375135 1:16026923-16026945 CCGCCCCGCCCCGCCGCCCCCGG - Intronic
902476958 1:16693379-16693401 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
902584985 1:17433413-17433435 CCGCCCTGCCCCGCCGCCCCGGG - Intronic
902823109 1:18955636-18955658 CGCCCCTCCCCCGCCGCCCTGGG - Intronic
902870739 1:19312277-19312299 CCGCGCGCCACCGCCCCCGCGGG - Intergenic
903349952 1:22711328-22711350 CCACGCGCGCTCGCCGCCCCCGG + Intronic
903398408 1:23020008-23020030 CCGCCCTCCCCCGCCGCCGCCGG + Intronic
903522210 1:23959503-23959525 GCGCGCGGGCTCGCCGCCCTTGG - Intronic
903670908 1:25034745-25034767 CTGCGCGCCCCAGGAGCCCTGGG - Intergenic
903907389 1:26696448-26696470 CCCGCCGCCGCCGCCGCCCTCGG + Exonic
904045155 1:27604183-27604205 CCGCGCGCGCGCTCCCCCCTGGG - Intronic
904517289 1:31066027-31066049 CCTCGCGCCCGCCGCGCCCTCGG + Intergenic
904772209 1:32886633-32886655 CCCAGCGCCCCCGCCACCCGGGG - Intronic
907278001 1:53327606-53327628 CCCCCCGCCCCCGCGGGCCTCGG - Intronic
907540880 1:55214901-55214923 CCGCGGGCCCCCGCCGGGCCCGG + Exonic
907541018 1:55215383-55215405 AGGCGCGGCCCCGCCGCCCGGGG - Intergenic
908555591 1:65254320-65254342 CCGCGCGCACCCGCACGCCTCGG + Intronic
912492620 1:110070472-110070494 CCGCGCCGCCCCGCGGCCCGCGG - Exonic
912505051 1:110150610-110150632 CCGCGCGCTCTCTCCGCCGTGGG + Exonic
912625756 1:111203887-111203909 CCGCCCCACCTCGCCGCCCTGGG - Intronic
912955874 1:114153809-114153831 ACCCGCGCCCCGGCCGCACTGGG + Intronic
913300754 1:117366992-117367014 CAGCGCGCCCACGCCGCTCGGGG - Intergenic
914813690 1:151047899-151047921 CCTTGGGCCCCCGCCGCCCGGGG - Exonic
914869292 1:151459363-151459385 CGGGGCCCCCCCGCCCCCCTCGG - Exonic
915073682 1:153292468-153292490 CCCAGCACCCCCGCAGCCCTGGG + Intergenic
916107005 1:161440287-161440309 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916108566 1:161447701-161447723 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916110154 1:161455082-161455104 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916111739 1:161462492-161462514 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916113326 1:161469873-161469895 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916144631 1:161727440-161727462 CTGCGCTCCGCCGACGCCCTTGG + Exonic
916548295 1:165827482-165827504 CCGGGCCCCGCCGCCGCCCGAGG - Intronic
917846694 1:179026020-179026042 CCGGCCGCCCCCGCCGCCTCCGG - Exonic
918487494 1:185045320-185045342 CCGCGCCACCGCCCCGCCCTGGG - Intergenic
919830853 1:201539260-201539282 CCCCGCACCCGCGCTGCCCTTGG + Intergenic
921384073 1:214551822-214551844 GCGCGCGCCCGCGGCGCCCCCGG - Intronic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922306977 1:224352737-224352759 CCGCGGGCCCCGCCGGCCCTGGG - Intergenic
923007920 1:230067082-230067104 CCGCGCGGCGCCGCCGGCCCGGG + Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
923506807 1:234611208-234611230 CCGGTCGCCCCCACGGCCCTCGG - Intergenic
924613173 1:245590294-245590316 CCGCGGGGCCCAGCCGCCCCGGG - Intronic
1062843599 10:689147-689169 CCGCGATCCCCCCGCGCCCTGGG - Intronic
1062843805 10:689765-689787 TCGCGCGCCCCCGCGCCCCACGG + Intergenic
1065390076 10:25174574-25174596 TCCCGCGCCCCCGCCGCCCGCGG + Intergenic
1066023082 10:31320830-31320852 CCCTGCGCTCCCGCCGCCCCCGG - Intronic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1069019144 10:63465991-63466013 CTGCGCGCCGCCGCTGCCCGGGG - Intergenic
1069831466 10:71284715-71284737 CCTCGCGCACCCGCAGGCCTGGG - Exonic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1075129542 10:119726226-119726248 CCGCGGGCCGCCGCCTCCCTGGG + Exonic
1075629461 10:123992238-123992260 ATGGGCACCCCCGCCGCCCTGGG - Intergenic
1075697487 10:124447628-124447650 CCGCCGCCCCCCGCCGCCCCTGG + Exonic
1076554275 10:131311787-131311809 GCCCGCGCCGCCGCCGCCCCCGG + Intergenic
1076993819 11:289056-289078 GCGACCGCCCCCGCCGCCCAGGG + Intergenic
1076999596 11:315989-316011 CCGCGCACCCCCGACGCCCGTGG - Intergenic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1077250153 11:1557300-1557322 CCCCGCGCCCCCCACGCCCCCGG - Exonic
1077492821 11:2870006-2870028 CCGCGCGCTCCCTCCCGCCTGGG + Intergenic
1077891170 11:6419106-6419128 GCGCGCGCCTCCGCCGCTCGGGG - Intronic
1078057407 11:8019254-8019276 CCCAGCGCCGCCGCCGCCCGCGG + Intronic
1081970953 11:47198355-47198377 CCGCCCGCCCCGGCCTCCCAAGG - Intergenic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083227733 11:61295205-61295227 CCGCGTCCCCTCGCGGCCCTCGG - Exonic
1083648458 11:64186418-64186440 CCGCTCCCGCCCGCCGCCCGCGG - Intronic
1083660797 11:64251037-64251059 CCGCGCGGTCCCCCCTCCCTGGG - Intergenic
1083670942 11:64299674-64299696 CCGTGCGGCCCCGCGGCCCCGGG + Exonic
1083747642 11:64744652-64744674 CAGCCCGCCCGCGCCGCCCTGGG + Intronic
1084128626 11:67118033-67118055 CGGCCCGACCCTGCCGCCCTGGG - Intergenic
1084128897 11:67118798-67118820 CCGCCCTCCCCCACCCCCCTGGG - Intergenic
1084814820 11:71639793-71639815 CCCCGCGCCCCCGGCACCCCCGG - Intergenic
1084887998 11:72223382-72223404 CCGCGTCCCCCTTCCGCCCTCGG + Intergenic
1084973123 11:72781943-72781965 GCGCCCGCCCCCGCCGGCCCTGG + Intronic
1088053863 11:105552256-105552278 CCGCCCGCCTCAGCCGCCCAAGG - Intergenic
1089432653 11:118436559-118436581 CCCCCCGCCGCCGCCGCCCCCGG - Exonic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1089966253 11:122656561-122656583 CCGCAGGGCCCCGCCTCCCTAGG - Intronic
1090799084 11:130159671-130159693 CTGCCCGCCCCCGCCGGCCCTGG - Exonic
1091616109 12:2052652-2052674 CCGCGCGCCCCGGCCTCCCCGGG + Intronic
1091718519 12:2795863-2795885 CCGCGCGGCGCCCCCTCCCTCGG + Intronic
1093164566 12:15789785-15789807 CCGAGCGCTCCCTCCGCCCGGGG - Intronic
1093435318 12:19129658-19129680 CCGCGCGCGCCCTACCCCCTCGG - Intergenic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1094624037 12:32106523-32106545 CCGGGCGCCCACGCCGCTCTCGG + Intergenic
1096127678 12:49131489-49131511 CCGCGCGCCCACTCCGCGCCCGG + Intergenic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096241249 12:49961545-49961567 CCGTGCGCCCCGGACTCCCTGGG - Intergenic
1096459384 12:51814041-51814063 GCGCGCGCCCCCGGGGGCCTGGG - Intergenic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1097872102 12:64610409-64610431 GCCCGCGACCCCGCCTCCCTGGG - Intergenic
1098024715 12:66189452-66189474 CTGGGCTCCCCCGCCGCCCCCGG - Intronic
1099114047 12:78601885-78601907 CCGCCCGCCCCAGCCTCCCAAGG - Intergenic
1102933570 12:116879816-116879838 CCGCGCGCCGCAGACACCCTGGG - Intronic
1103074267 12:117969309-117969331 CCGGCCTCCCCCGCCGCCCCCGG - Intergenic
1103764488 12:123271145-123271167 GCGCGGGGCCCCGCCGCCCTGGG - Intronic
1103764650 12:123271621-123271643 CCCGGCGCGCCCGCCGCCCGGGG - Exonic
1103856286 12:123973009-123973031 CCCCGCGCCCCCCCCTCCCTCGG - Intronic
1104697284 12:130872532-130872554 TCGCGCGGCCCCGCAGCCCATGG - Intronic
1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG + Exonic
1105964528 13:25372323-25372345 CCCCGCGCCGCCCCCGCCCCGGG - Intronic
1106303855 13:28494101-28494123 CCGCTCCTCCCCGCCGCTCTCGG - Intronic
1106995055 13:35471286-35471308 CCTCGCGCCGACACCGCCCTCGG - Intronic
1110450912 13:75636563-75636585 CCGCGTGCCCTCCCCGCCCGTGG + Intronic
1111397053 13:87677587-87677609 CCGCGGGCCCGCGCTGCCCAAGG + Exonic
1111556187 13:89884091-89884113 CCGGCCGACCCCGCCGCCCCAGG - Intergenic
1111672749 13:91348958-91348980 GCCCGCGTCCCCGCCGCACTCGG + Intergenic
1112290892 13:98143361-98143383 GCCCGCGCCGCCGCCGCCCGCGG + Intronic
1112344207 13:98576874-98576896 CCGGCCGGCCCCGCCGCCCGAGG - Intronic
1113768371 13:112894419-112894441 CCGCGCGCACCTGCCGCCCGTGG - Intronic
1113841615 13:113364287-113364309 CCCCGCCCCTCCCCCGCCCTGGG - Intergenic
1113841667 13:113364393-113364415 CCCCGCCCCTCCCCCGCCCTGGG - Intergenic
1114627932 14:24141477-24141499 CCGCCGGCTCCCGGCGCCCTGGG + Exonic
1114649017 14:24271454-24271476 CCGGGCACCCCCGCCCCCCGCGG + Exonic
1118776988 14:68979334-68979356 CCCCCCGCCCCCGCCCGCCTCGG - Intronic
1118809008 14:69260391-69260413 CTGCGCGCCCCGGCCGCCGGAGG - Exonic
1119487717 14:75002740-75002762 CCGCGCGCCCCCGCGCCTCGGGG - Intergenic
1119808679 14:77498916-77498938 CTGCGCGCCCCCGCCCCGCGCGG - Intergenic
1119824002 14:77642009-77642031 CCGCGCATCCTCCCCGCCCTTGG - Intergenic
1121184095 14:91951538-91951560 CCGCCCGCCTCAGCCGCCCAAGG - Intergenic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122194365 14:100074001-100074023 CCCCCCGCCCCCACCGCCCCCGG - Intronic
1122226906 14:100285607-100285629 CTCCGCGCCCCCGTGGCCCTGGG - Intergenic
1122905708 14:104800629-104800651 ACGCGCGCCAGGGCCGCCCTGGG + Intronic
1123004936 14:105316588-105316610 CCACACGCCCCCACCTCCCTTGG - Intronic
1123024986 14:105420167-105420189 CCGCCCGCCCTCGCGGCCCCCGG + Intronic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1123664694 15:22599103-22599125 CCGCCCGCCTCGGCCTCCCTGGG + Intergenic
1124318528 15:28693541-28693563 CCGCCCGCCTCGGCCTCCCTGGG + Intergenic
1124322682 15:28726727-28726749 CCGCCCGCCTCCGCCTCCCTGGG + Intronic
1124328058 15:28783970-28783992 CCGCCCGCCTCCGCCTCCCAGGG + Intergenic
1124523513 15:30426861-30426883 CCGCCCGCCTCCGCCTCCCTGGG + Intergenic
1124523591 15:30427305-30427327 ACGCCCGCCTCCGCCTCCCTGGG + Intergenic
1124535076 15:30538910-30538932 ACGCCCGCCTCCGCCTCCCTGGG - Intergenic
1124535154 15:30539353-30539375 CCGCCCGCCTCCGCCTCCCTGGG - Intergenic
1124564916 15:30803894-30803916 CCGCCCGCCTCGGCCTCCCTGGG - Intergenic
1124763499 15:32468244-32468266 CCACCCGCCTCCGCCTCCCTGGG + Intergenic
1124763574 15:32468691-32468713 ACGCCCGCCTCCGCCTCCCTGGG + Intergenic
1124775052 15:32580360-32580382 ACGCCCGCCTCCGCCTCCCTGGG - Intergenic
1124775129 15:32580805-32580827 CCACCCGCCTCCGCCTCCCTGGG - Intergenic
1126137164 15:45403096-45403118 CCGCGCGCCCTGACCGCGCTGGG + Exonic
1126150923 15:45522892-45522914 CCGCGCGCCCCCGCCCATCGCGG - Intergenic
1127103175 15:55588010-55588032 GCCCGCGTCCCCACCGCCCTCGG - Intronic
1127867336 15:63043060-63043082 ACGCGCGCCCTGGCCGCCCTGGG - Intronic
1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG + Intergenic
1129862395 15:78872789-78872811 CCCTGCGCCCGCGCCGCCCCAGG - Intronic
1130076708 15:80695656-80695678 CCCCGCGCCCGCGCCCTCCTCGG - Exonic
1131263745 15:90903444-90903466 CCCCCCGCCGCCACCGCCCTCGG - Intronic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132398235 15:101489578-101489600 CCCCGCGCCCCCCGCGCCCGCGG + Exonic
1132419422 15:101652563-101652585 CCACGCGCCCCTCACGCCCTTGG + Intergenic
1132480951 16:165889-165911 CCCCGCGTTCCCGCCGCGCTCGG + Intronic
1132555508 16:570225-570247 CCCCGGGCCCGCGCCGACCTGGG + Intronic
1132589788 16:721602-721624 CCGCGCGCTCGCGCCGACGTAGG - Exonic
1132719686 16:1309616-1309638 CCGCGCGCCCCGCCCGCGCCAGG + Intronic
1132760865 16:1508081-1508103 CCCCGCCCACCCGCCTCCCTGGG + Intronic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1133020194 16:2963737-2963759 CCGCACGCCCCTCCCGCCCCTGG - Intergenic
1133370058 16:5240129-5240151 CCCCGCGCCCCCGGCACCCCCGG - Intergenic
1133771479 16:8869104-8869126 CCGCCCGCCCCCACCGTCCCGGG - Intergenic
1134614892 16:15643265-15643287 CCGCGAGGCCCCGCCCCCCCCGG - Exonic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1137618156 16:49858725-49858747 CCCCACGCCCCCGCGGCCCAGGG + Intergenic
1137655235 16:50153457-50153479 CTGCGCGACCGCGCCGCCCGCGG + Intronic
1139754581 16:69132367-69132389 CCGCGCGCCCCGCCCGGCCCCGG + Intronic
1139779641 16:69339930-69339952 CCGCGCCCCCACTCCACCCTTGG - Intronic
1140481786 16:75266095-75266117 CCGCGCCTCCCCGCCGCGTTGGG - Intronic
1141075954 16:81006883-81006905 CTCCTCGCCCCCGCCGCCCGCGG + Exonic
1141531247 16:84648493-84648515 GCGCGCGCCGCCTCCGCCCTCGG + Intergenic
1141972355 16:87492477-87492499 CCGGCCGCCCCGGCCGCCCCGGG - Intergenic
1141989644 16:87602674-87602696 GCGGGCCCCGCCGCCGCCCTCGG + Intronic
1142004953 16:87685290-87685312 CCCCGCACCCCCACCGCCTTGGG + Intronic
1142156229 16:88533919-88533941 CCGGCCGCCCGCGCCGTCCTCGG - Exonic
1142193063 16:88726679-88726701 CCCCCCGCACCCACCGCCCTGGG - Intronic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1142757711 17:2025532-2025554 CCGCGCGGCGCCGCCTCCCAAGG + Intergenic
1142848255 17:2692315-2692337 CCGCAGGCCTCCGCCGGCCTTGG + Intronic
1143024127 17:3930895-3930917 CCACCCGCCTCCGCCTCCCTGGG - Intronic
1144127638 17:12217788-12217810 CCGCTCCCCCCCCCCACCCTTGG - Intergenic
1144756083 17:17681531-17681553 CCGGGCGCCGCCCCCGCCCGCGG + Exonic
1144756184 17:17681838-17681860 CCTCGCGCCGCCCCCGCCCCGGG - Intronic
1144784436 17:17823826-17823848 ACTCGAGCCCCCGCCGCCGTGGG - Intronic
1144828827 17:18120891-18120913 CCGCCGCCACCCGCCGCCCTGGG + Exonic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1146053008 17:29567465-29567487 CCGCGCGCGCGCTCTGCCCTCGG + Intronic
1146935162 17:36808578-36808600 CCCCGCGCCCCCGGCTGCCTCGG - Intergenic
1147139656 17:38453954-38453976 CCGGGAGCCCCCGCCGGCCGCGG + Intronic
1147139700 17:38454113-38454135 CCGCGCGCCCGGGCCGCGCCGGG + Intronic
1147168700 17:38606044-38606066 TCCCCCGCCCCCGCCGCCCCGGG - Intergenic
1147582560 17:41635550-41635572 CCGCGGGCCCTGGCTGCCCTGGG - Intergenic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1148733448 17:49851424-49851446 CTGCGCCCACCCGGCGCCCTGGG - Intergenic
1149610387 17:57954952-57954974 CCGCACGCCCCCCGCGCCCGGGG + Intronic
1150294101 17:63998691-63998713 CCGCGCACACCCCCAGCCCTGGG + Exonic
1151205232 17:72501802-72501824 CCTCGCTCCCCAGCCGCCCAAGG + Intergenic
1152049211 17:77959162-77959184 CCGCGCACTCCCGAGGCCCTCGG + Intergenic
1152406614 17:80101595-80101617 ACGCGCGCCCTGGCCGCCCGCGG - Intergenic
1152802394 17:82337032-82337054 CCGCGCACCCCCGGCCACCTGGG + Intergenic
1152808879 17:82371896-82371918 CCTCGCGCCCCCTCTGCGCTGGG + Intergenic
1153006273 18:500803-500825 TCCCGCGCCCGCCCCGCCCTCGG + Intergenic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1155211052 18:23602277-23602299 CCGCCCGCCTCCGCCTCCCAAGG + Intronic
1155519805 18:26656796-26656818 CTGGGCGCCCCCGCGGCGCTGGG + Intronic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1157614087 18:48976524-48976546 CGGAGCGCCGCCGCCTCCCTGGG + Intergenic
1158435948 18:57435679-57435701 CCCGCCGCCCCCGCCGCCCCCGG + Exonic
1159021231 18:63144871-63144893 ACCCCCGCCCCCGCCGCCCTGGG + Intronic
1159241723 18:65750895-65750917 CAGCGGGCCCCCGGCGCCCGAGG + Intronic
1159770867 18:72543894-72543916 CCGAGCGCTGCCGCCTCCCTAGG + Intronic
1160404810 18:78638128-78638150 CAGGGCGCCCCGGCCGGCCTGGG + Intergenic
1160453389 18:78979919-78979941 CCGCGCTCCTCGGCCGCCCCGGG - Intergenic
1160455162 18:78994475-78994497 CTGCCCGCCCTCCCCGCCCTCGG + Exonic
1160767151 19:813721-813743 GCGCGCCCTCCAGCCGCCCTGGG + Exonic
1160909219 19:1467206-1467228 CCCGGCGCCCCCGCCGCGCTCGG - Exonic
1160930594 19:1568014-1568036 GCCCCCGCCCCCGCCGCCGTCGG + Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161157415 19:2739900-2739922 CCGCCCCGCCCCGCCGCCCCAGG + Intronic
1161203698 19:3029371-3029393 CCCCGCGCCCGCGCCCCCCCCGG + Intronic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161450633 19:4343611-4343633 CCCCGCGCCTCCGCCCCGCTGGG - Intronic
1162486012 19:10961019-10961041 GCGCGCGCGCCCGCCCGCCTCGG - Exonic
1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG + Intronic
1162524225 19:11197880-11197902 CCGCGCGCCCTCCCCGAGCTGGG - Intergenic
1162741360 19:12775559-12775581 CCGCCCCGCCCCGCCCCCCTAGG + Intronic
1162778336 19:12993740-12993762 GCGTGCGCACCCCCCGCCCTGGG + Intergenic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1163443795 19:17334779-17334801 GCGCCCGCCCGCGCCGGCCTCGG + Exonic
1163577162 19:18117789-18117811 CGCCCCGCCCCCGCCGCCCGCGG + Intronic
1165065485 19:33225856-33225878 TCCCGGGCCCCCGCCGCCCGGGG - Intergenic
1165345680 19:35247982-35248004 CCGCGCCGCGCCCCCGCCCTCGG + Intergenic
1165415831 19:35692843-35692865 CCGCGCCCCCCCGCCCGGCTAGG - Intergenic
1165772888 19:38388815-38388837 CCCCGCCCCCTCGCCCCCCTCGG - Intronic
1165928697 19:39342687-39342709 CCGCCCGCCGCCGCCGCCCGCGG - Intronic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
1166121803 19:40691026-40691048 CTGCCCGCCCCCGCCGGGCTGGG - Intergenic
1166751624 19:45166596-45166618 CCTCACGCCCCAGCCGTCCTGGG - Intronic
1167250993 19:48398403-48398425 CCGGTGGCCCCCGCGGCCCTCGG + Exonic
1167643782 19:50695248-50695270 CCCCGCGCCCCCGCGCCCCCCGG - Intronic
1168076311 19:53982512-53982534 CCCCGCGGCCACGCTGCCCTTGG - Exonic
1168155441 19:54471556-54471578 GCGCGCGCCCGCCCCGCTCTGGG - Exonic
1168297302 19:55383736-55383758 CTGCCCGCGCCCGCCGCCCCGGG + Exonic
1202710974 1_KI270714v1_random:19205-19227 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
927868125 2:26606027-26606049 CCGCGCCTCCCCCCTGCCCTTGG - Intronic
927904616 2:26847942-26847964 CCGCGCGCCGCCGCCGCCTGGGG - Intronic
927964826 2:27262361-27262383 CCGCGCGCCCCCTCCAGCCGCGG - Intronic
929151232 2:38750916-38750938 CCCCCCTCCCCCCCCGCCCTCGG - Intronic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
929789590 2:45013324-45013346 CCGAGCGCCCCAGCCGACATGGG + Intergenic
931374412 2:61694815-61694837 CCGCCCCACCCCGCCTCCCTTGG - Intergenic
931517807 2:63059866-63059888 CCGCCGTCCCCCGCCGCCCCCGG - Intergenic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932696563 2:73961785-73961807 CCGCCCGCCTCGGCCTCCCTAGG - Intergenic
936433181 2:112482008-112482030 CCCTGCGCCGCCGCCGCCCCCGG + Intergenic
937221684 2:120345944-120345966 CCTCGGGCCCCCGGGGCCCTCGG + Intergenic
940971973 2:159904797-159904819 GGCCCCGCCCCCGCCGCCCTCGG + Intergenic
941164865 2:162074036-162074058 ACGCGCGTCTCCGCCGCCCGCGG - Exonic
941951308 2:171160201-171160223 CCCCCCGCCCCCCCCGCCCCGGG - Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
945080927 2:206085670-206085692 CCGCCCGCCGTCGCCGCCCGCGG + Intronic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946966421 2:225042201-225042223 CCGCGCGCCCCAGGCGCCCGGGG - Intronic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948945699 2:241217976-241217998 CTGCGCGCCCCCGCTGCCCCCGG - Intronic
1168757151 20:325699-325721 CGGCGCGCCCCCGCCGCCTCCGG - Exonic
1168878250 20:1185522-1185544 CCGGGCGCCCTCGCCGGCCGCGG - Intronic
1169074412 20:2752273-2752295 CCGCGCCTCCCCGCCGTCCTCGG + Intronic
1169088418 20:2841174-2841196 CCGTGCGATCCCGCCCCCCTCGG - Intronic
1170999273 20:21396833-21396855 CCGCGCGCCCGCTCGGCCCCAGG + Intronic
1170999285 20:21396880-21396902 TCCCGCGCCCCCGCGCCCCTCGG + Intronic
1172421979 20:34825522-34825544 CCGTGCGTGCCCGCCGCCCTCGG + Intronic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1173322259 20:41998696-41998718 CTGCGCGGCGCCGCAGCCCTGGG + Intergenic
1174204338 20:48828018-48828040 CCGCGCGCTGCCTCCGCCCCCGG - Intergenic
1174204477 20:48828486-48828508 ACGCGCGCCTCCGCGGCCCCGGG + Intergenic
1175461669 20:59156280-59156302 CCGCTCGCCTCAGCCTCCCTGGG - Intergenic
1176381048 21:6112019-6112041 ACCAGCGCCCCCGCCGCCCGCGG - Intronic
1177011044 21:15730327-15730349 CCTCGCGCCTCCGCCGGCCCTGG - Exonic
1177187968 21:17819108-17819130 CCGCGCGCCCCCAACGCCGAAGG - Intronic
1178922494 21:36747828-36747850 CTGCGCGCCCCCGACCCCCGAGG + Exonic
1179243795 21:39612975-39612997 CCGCGCGCCCCCTGCGTCCGCGG + Intronic
1179742424 21:43426221-43426243 ACCAGCGCCCCCGCCGCCCGCGG + Intronic
1179784054 21:43719692-43719714 CCGCCCGCCCCCGCGGCAGTTGG - Intronic
1179810253 21:43865393-43865415 CCACGCCCCGCCGCCGCCCGAGG + Intronic
1179968046 21:44818153-44818175 CTGCGCGCGCCCGACGCCCCGGG - Intronic
1180064234 21:45404916-45404938 TCGCCCGTCCCCGCCGCCCCCGG + Intergenic
1180871863 22:19150809-19150831 CCGCACGATCCCGCCGCGCTCGG + Intergenic
1180910690 22:19447864-19447886 GCGCGCGCCGCAGCCGCCCTCGG - Exonic
1180949384 22:19714394-19714416 CCGCCCCCCCGGGCCGCCCTGGG + Intergenic
1180960677 22:19761024-19761046 CCGTGCGCCGCCGCCGCCCCCGG + Exonic
1181017678 22:20080483-20080505 CCGCGCCCCCGCCCCGCCCGCGG - Intronic
1181026781 22:20131615-20131637 CCGCGGGCGCCCGCCGGGCTGGG + Intronic
1181094360 22:20495634-20495656 GCGCCCGCCCCCGCGCCCCTCGG + Intronic
1181570925 22:23767544-23767566 GCCCGCGCACCCACCGCCCTCGG - Exonic
1181610871 22:24011169-24011191 ACGCGCGCGCGCGCCGCCCAAGG + Intergenic
1182296497 22:29313551-29313573 TCGGGCGCGCCCGCCGGCCTGGG + Exonic
1182355372 22:29720334-29720356 CCGCCCGCTCCAGCCGCCCCCGG + Exonic
1183427225 22:37746384-37746406 CCTCCTGCTCCCGCCGCCCTGGG + Intronic
1183437727 22:37805045-37805067 CTGCTCCCCGCCGCCGCCCTGGG - Intergenic
1183560790 22:38570711-38570733 CCCCCCGCCCCCGCTGCCCATGG + Intergenic
1183831115 22:40418723-40418745 GCCCCCGCCCCCGCCCCCCTCGG - Exonic
1184101463 22:42343643-42343665 CCGCGCGCCCCGGCCGGCCCGGG + Intergenic
1184276522 22:43412083-43412105 CCGGGAGCCCCTGCCTCCCTCGG + Intronic
1184680612 22:46070770-46070792 CCGTGCGCGCGCTCCGCCCTGGG + Intronic
1184711218 22:46250493-46250515 CCGCGCGCTCCCGCAGCGCACGG - Exonic
1184712818 22:46263120-46263142 CCGCCCGCCCGCACCGCGCTGGG + Exonic
954076867 3:48188032-48188054 CCGCGCGCCACCGGCGCCCGCGG + Exonic
954693790 3:52409940-52409962 CCGGGAGCCCCCACCGCCCCCGG + Exonic
955271296 3:57502148-57502170 CCGCCCGCCTCGGCCTCCCTGGG + Intronic
955687517 3:61561931-61561953 CTGCTCGCCGCCGCCGCCCGCGG + Exonic
956418100 3:69054280-69054302 CCACCCCCCCCCGCCCCCCTCGG - Intergenic
957072871 3:75579932-75579954 CCCCGCGCCCCCGGCACCCCCGG + Intergenic
961574462 3:127823244-127823266 CCGCGCGTCCCCACCCACCTCGG - Intronic
961831837 3:129626995-129627017 CCCCGTGCCCCCGCCCCCCTAGG - Intergenic
967271644 3:187737980-187738002 CCCAGCGGCCCCGCCTCCCTGGG - Intronic
967859741 3:194141715-194141737 CCGCGCGGCCCCGCCGGGCCTGG + Intergenic
968161641 3:196432028-196432050 CCGTCCGCCCCCGCCGGCCCGGG - Intronic
968225434 3:196969518-196969540 CCGCGCGCCGTCGCCGACCCCGG - Intergenic
968515139 4:1012543-1012565 CCGCCGGCCGCCGCCGCCCGAGG + Exonic
968612199 4:1562441-1562463 CCTCGCGCCTCGGCCGCTCTCGG - Intergenic
968620779 4:1602663-1602685 CCGCGCGCCCCCTCCCCGCCAGG + Intergenic
968652953 4:1767300-1767322 CCCCGCGCCCCTCCCGGCCTGGG + Intergenic
968740792 4:2330823-2330845 CCCCACGCACCCGCTGCCCTGGG - Intronic
968775395 4:2536856-2536878 CCGCCCTCCGCCGCCGCCCGCGG + Intronic
968882463 4:3308489-3308511 CCTCGCACCCCAGCCGCCCGCGG - Intronic
969016479 4:4107234-4107256 CCCCGCGCCCCCGGCACCCCCGG + Intergenic
969457085 4:7306304-7306326 CCGCCCTCCCCCTCCACCCTCGG - Intronic
970456109 4:16226185-16226207 CAAGGCGCCCCCGCCGCCCTCGG + Intronic
970574566 4:17414462-17414484 CTGCCCGCCCGCGCCGCACTCGG - Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
972311934 4:37890660-37890682 CCCCGCGCCCCCGGCTCCCCAGG + Intergenic
972312200 4:37891537-37891559 CCCCCCACCCCCGCCGCCCTTGG + Intronic
972418801 4:38867869-38867891 CCGCGCTCGCCCGCCCCCCGGGG - Intronic
975622074 4:76306235-76306257 CCGCGCGTCACCGACGCCCGCGG + Intronic
977606949 4:98993748-98993770 CCGGCCGGCCCCGCCGGCCTCGG - Intergenic
977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG + Exonic
978013735 4:103719462-103719484 CCCCGCGCCCTCCCAGCCCTGGG - Exonic
978576953 4:110197777-110197799 CCTCTCCCGCCCGCCGCCCTTGG - Intronic
980930279 4:139177435-139177457 CCGCGGGGCCCCGCCGCCCTCGG + Intergenic
981782880 4:148445562-148445584 CCGCGCGCCCCCGCGTCTCCTGG + Intergenic
982157215 4:152535275-152535297 CCCCCCGGCCCCGCCGCCCTCGG + Exonic
985068446 4:186144978-186145000 TCACGCGCCCCCGCGGCCCCGGG - Exonic
985550151 5:528683-528705 CCCCGCTCCCCCGCGCCCCTGGG + Intergenic
985713722 5:1444702-1444724 CGGCAAGCCGCCGCCGCCCTGGG + Intronic
987050407 5:14143573-14143595 CCGCCGCCCCCCGCCGCCCCGGG + Intergenic
987239942 5:15985830-15985852 CCGCGCGCCTCAGCCTCCCAAGG + Intergenic
988437579 5:31194033-31194055 CCGCGCGCCCGCCCCGACCCGGG - Intronic
992726552 5:79612811-79612833 CCGTGCCCCGCCGCCGACCTGGG - Exonic
994072802 5:95620756-95620778 GCGCGTGCCCTCGCCGCCCTGGG + Exonic
994251531 5:97542141-97542163 CCGGCTGGCCCCGCCGCCCTGGG - Intergenic
995724675 5:115170237-115170259 CCCCGCCCCGGCGCCGCCCTCGG - Intronic
997382645 5:133448723-133448745 CCCCCCGCCCCCGCACCCCTGGG - Intronic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
998119048 5:139561361-139561383 CCGCCCGCCCGCGCGTCCCTCGG + Exonic
998138697 5:139688103-139688125 CCCCGCCCACCCGCAGCCCTGGG + Intergenic
999248293 5:150167038-150167060 CCCCGCGCCCCCGACGGCCTGGG + Exonic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1000071358 5:157743797-157743819 CCGCGCGCCCGCCCAGCCCGCGG + Exonic
1000698052 5:164413870-164413892 CCGCGCGCCTCGGCCTCCCAAGG - Intergenic
1001506435 5:172283900-172283922 CCGCGCGCCGCCCTCGCCTTCGG + Exonic
1002364584 5:178700126-178700148 CTGCAGGCCCCCGTCGCCCTGGG + Intergenic
1003175606 6:3750960-3750982 CCGGGCGCCCCCGCCCTCCTCGG + Intronic
1003544902 6:7051438-7051460 CTCCGCGCCGCAGCCGCCCTCGG - Intergenic
1003897022 6:10617278-10617300 CCGGCCGGCCCCGCCGCCCGGGG - Intronic
1003901581 6:10659985-10660007 CCGGGCGACCCCGCCGGCCTTGG + Intergenic
1004228991 6:13814248-13814270 CCTCGCGCCCCGGCGGCCCGCGG - Exonic
1004690328 6:17987653-17987675 CCGCGCGCCCGCCCCTCCCCGGG - Intergenic
1005040414 6:21595457-21595479 TCCCGCGCCCACGCCGCCCACGG - Exonic
1007465688 6:42049586-42049608 CCGCGGGCACCCCACGCCCTGGG + Intronic
1007605362 6:43114037-43114059 CCACCCGCCCCAGCAGCCCTGGG - Intronic
1007748734 6:44059003-44059025 CCCCTCTCCCCCGCCTCCCTGGG + Intergenic
1007800505 6:44388145-44388167 CCCCGCCCCCCCGCCCCCCCCGG + Intronic
1010001514 6:70954905-70954927 CCGCCCCCCCCCGCCGCCCCCGG - Intronic
1010083103 6:71886723-71886745 CTGCCCGCCCCCGCCGGCCGAGG + Intronic
1010204972 6:73314714-73314736 CCGCGCTCCCCCGCCCTTCTCGG + Intergenic
1010756531 6:79671774-79671796 CTGCCTGCCCCCGCCACCCTAGG + Intronic
1013538881 6:111087946-111087968 CAGCCAGCCCCAGCCGCCCTCGG - Exonic
1014233979 6:118935031-118935053 CCGCGCGTCCCCGCGGCCGGTGG - Exonic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1016969545 6:149749646-149749668 CCACACGCCTCCCCCGCCCTCGG + Exonic
1017672353 6:156779074-156779096 GCTCGCGGCCCCGCCGCCCCCGG - Exonic
1017738021 6:157381292-157381314 CCGCGAGCCGCCGCCGCCCTCGG + Exonic
1017738130 6:157381659-157381681 CCGCTCGGCCCCGCAGCCCCCGG - Exonic
1017793634 6:157823068-157823090 CCGCGCCGCGCCGCCGCCCCGGG - Intronic
1018123237 6:160657638-160657660 CTGCCCGCCCCCGCCTCCCAAGG + Intronic
1018134661 6:160767526-160767548 CCGGGCGCCCTCGCCTCCCTGGG - Intergenic
1018150205 6:160930888-160930910 CTGCGCGCCCTCGCCTCCTTGGG + Intergenic
1018238943 6:161753696-161753718 CCGAGCCCCCCCGCCCCCATTGG - Intronic
1019048911 6:169168428-169168450 CCTGGCGCCGCCGCCGCCCTGGG - Intergenic
1019386565 7:760055-760077 CCGCGCGGCCCCGTCTCCCTCGG - Intronic
1019711348 7:2519554-2519576 CCCCGCACCCCCCCCGCCCCGGG - Intronic
1019711460 7:2519965-2519987 CAGCGCGCGCCGGCCGCGCTCGG - Exonic
1019765101 7:2844179-2844201 CCGCGCCCCGCCGGCGCCCGGGG + Exonic
1021614394 7:22487555-22487577 CCCCCCGCCCCCGCCATCCTCGG - Intronic
1022714979 7:32891357-32891379 CCGCGCCCCTCCCCCGCCCGCGG + Intronic
1023773689 7:43583336-43583358 CCGGCCGCCGCCGCCGCCCCAGG + Exonic
1023857438 7:44193279-44193301 CCTCTCTCCCCCGCCACCCTTGG + Intronic
1026598243 7:71752315-71752337 GCGCGCTCCCCCGCCGGCCTGGG - Intergenic
1026817069 7:73521697-73521719 CAGCGCGCCCCGGCCGCTCGCGG - Intronic
1027177788 7:75915500-75915522 CCCCGCGCCGCCGCCCCCCACGG + Intronic
1027190645 7:75994030-75994052 CCGCGCGCCGCCGAGGCCTTTGG - Intronic
1027260554 7:76461881-76461903 CCGCGCCACCCCGCGCCCCTGGG - Intronic
1027311933 7:76959994-76960016 CCGCGCCCCCCCGCGCCCCTGGG - Intergenic
1029149684 7:98470912-98470934 CGCCGCGCCCCCGCCCCCCAGGG + Intergenic
1029414736 7:100435831-100435853 CCGCCCGCCCCCCTCACCCTCGG + Exonic
1029424872 7:100489018-100489040 GCCGGCGCCCCCGCCGCCTTAGG - Exonic
1029461069 7:100694133-100694155 CCGCGCGCCGCCCACGCCCCGGG - Intergenic
1029537334 7:101164165-101164187 GCGCGCGCCCCTGCCGCCCCCGG - Exonic
1029672782 7:102045436-102045458 CCGCGCGCCCCCTCCGATGTGGG + Intronic
1032298925 7:130668806-130668828 CCGCCCTCCCCGGCCGCCCTCGG + Exonic
1032344391 7:131106041-131106063 CCGCGCGCCCCGGCAGGCCGGGG + Intergenic
1033033163 7:137846593-137846615 CCGCGGGTCCGCGCCGCCCTCGG + Exonic
1033159053 7:138981141-138981163 GCGCCCGCCGCCGCCGCCCGGGG - Exonic
1033299932 7:140176658-140176680 CCGGCCGCCCGCGCCTCCCTCGG - Intronic
1034192709 7:149224046-149224068 CCCATCGCCCCCGCCGCCCCCGG - Exonic
1034344817 7:150379556-150379578 CCGCGCGCCCCCCGAGCCCCGGG + Intronic
1034426936 7:151018899-151018921 CCGCGCGCCCCCAGCGCGCCAGG + Exonic
1034455501 7:151167815-151167837 CCGCCCGCCGCCGCCGCGCCCGG + Intronic
1034781841 7:153888130-153888152 CCTGGCGCCCGCGCCGGCCTCGG + Intronic
1035004429 7:155644654-155644676 CCGCGCGCCCGCGCCCGCCGCGG - Intronic
1035751814 8:2001853-2001875 CAGCGCGCCACCGACGCCGTGGG + Exonic
1036723708 8:11201006-11201028 CCGCCAACCCCCGACGCCCTCGG - Exonic
1036900309 8:12665232-12665254 CCCCGCGCCCCCGGCACCCCCGG + Intergenic
1037305152 8:17497032-17497054 CCGCGCCCCGCCCCCGCCCCGGG + Intergenic
1037819912 8:22130584-22130606 TAGAGCGCCCCCGCCGCCCCGGG - Exonic
1037878665 8:22561952-22561974 CCGCGCCCCTCCGCAGCCCTCGG - Intronic
1037985422 8:23288125-23288147 CGGCGCGTCGCAGCCGCCCTCGG - Exonic
1040055949 8:43056715-43056737 TCTCGCGCCGGCGCCGCCCTGGG - Intronic
1040065319 8:43140355-43140377 CCGGGCGCCTCCGCCTCCCGCGG + Intergenic
1040306218 8:46213212-46213234 GCGCTCGCCCACGCCACCCTAGG - Intergenic
1041449919 8:57995058-57995080 CCCCGCGCCCCCTCTGCGCTCGG + Intronic
1041502393 8:58553266-58553288 CCGCTCGCCGCCGCCGCCTCCGG - Exonic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042591775 8:70403662-70403684 CCGCCCGCCCTCGCGGCCCCGGG + Intronic
1042962945 8:74321704-74321726 CCGCGCGCGCCCGCCTGCCGAGG - Intronic
1049212236 8:141392102-141392124 CCGCGCGCCCCCGCCCCGAGCGG - Intronic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049654600 8:143792058-143792080 CCGCGTGCCCCGGCCTTCCTGGG + Exonic
1050500655 9:6294615-6294637 CCGCCCGCCTCCGCCTCCCAAGG + Intergenic
1051171538 9:14322595-14322617 CCGCGCGCCCAGGCCGGCCGTGG - Intronic
1051174014 9:14346121-14346143 CCACGCGCCCCCCGCGCCCGCGG - Intronic
1052192843 9:25678341-25678363 CCGCGCGGCCCCTCAGCCCACGG - Exonic
1053034093 9:34809922-34809944 CCCCGCGCCCCCGCGCCCCGAGG - Intergenic
1053397428 9:37787196-37787218 CCGCGTGCCCCACCCGCTCTGGG - Intronic
1055757776 9:79573241-79573263 CCGCTCGCCCCGGCGGCCCGCGG - Intronic
1056386104 9:86098909-86098931 AGGCGCGCTCCGGCCGCCCTGGG - Intronic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1056992371 9:91423797-91423819 CCGCGCGGCCACGGCGCCCGCGG - Exonic
1059942137 9:119369010-119369032 CCCCGCAGCCCCGCTGCCCTTGG - Intronic
1060087280 9:120714212-120714234 CCCCGCGGCCCCGCCGCCACCGG + Exonic
1061129826 9:128702681-128702703 CCGCGCCCCAGCGCCTCCCTCGG - Exonic
1061472174 9:130835345-130835367 GCGCGCCCCCCCGGCGCCCCCGG - Intronic
1061859457 9:133460456-133460478 CCCCGCCGCCCCCCCGCCCTGGG - Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062472530 9:136712736-136712758 CGGTGCGCGCCCGCCGCCCCCGG + Intronic
1062596509 9:137302178-137302200 CCGCGCGGCGCCGCCGTCCCCGG - Exonic
1062630773 9:137462142-137462164 CCGCCCGCCTCCGCCGCCGCGGG + Intronic
1062718669 9:138023592-138023614 CCGCGCGCGCCGCTCGCCCTTGG - Exonic
1185623195 X:1465853-1465875 CCGCGCGCCTCCGCTGCTCCCGG + Exonic
1189446220 X:41084613-41084635 CCTCGCGCCCCCGCAGCCAGTGG + Intergenic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1200292696 X:154887131-154887153 GCGCCCTCTCCCGCCGCCCTGGG + Exonic
1200339540 X:155382871-155382893 GCGCCCTCTCCCGCCGCCCTGGG + Exonic
1200346930 X:155457822-155457844 GCGCCCTCTCCCGCCGCCCTGGG - Exonic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic