ID: 923055886

View in Genome Browser
Species Human (GRCh38)
Location 1:230425902-230425924
Sequence CCGCGCGCCCCCGCCGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923055881_923055886 -10 Left 923055881 1:230425889-230425911 CCGGCGCCCTCCTCCGCGCGCCC No data
Right 923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG No data
923055880_923055886 2 Left 923055880 1:230425877-230425899 CCTCGAGCAGCGCCGGCGCCCTC No data
Right 923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923055886 Original CRISPR CCGCGCGCCCCCGCCGCCCT CGG Intergenic