ID: 923055887

View in Genome Browser
Species Human (GRCh38)
Location 1:230425908-230425930
Sequence GCCCCCGCCGCCCTCGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923055880_923055887 8 Left 923055880 1:230425877-230425899 CCTCGAGCAGCGCCGGCGCCCTC No data
Right 923055887 1:230425908-230425930 GCCCCCGCCGCCCTCGGCCATGG No data
923055882_923055887 -10 Left 923055882 1:230425895-230425917 CCCTCCTCCGCGCGCCCCCGCCG No data
Right 923055887 1:230425908-230425930 GCCCCCGCCGCCCTCGGCCATGG No data
923055881_923055887 -4 Left 923055881 1:230425889-230425911 CCGGCGCCCTCCTCCGCGCGCCC No data
Right 923055887 1:230425908-230425930 GCCCCCGCCGCCCTCGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923055887 Original CRISPR GCCCCCGCCGCCCTCGGCCA TGG Intergenic