ID: 923055892

View in Genome Browser
Species Human (GRCh38)
Location 1:230425914-230425936
Sequence GCCGCCCTCGGCCATGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923055884_923055892 -8 Left 923055884 1:230425899-230425921 CCTCCGCGCGCCCCCGCCGCCCT No data
Right 923055892 1:230425914-230425936 GCCGCCCTCGGCCATGGCCCCGG No data
923055880_923055892 14 Left 923055880 1:230425877-230425899 CCTCGAGCAGCGCCGGCGCCCTC No data
Right 923055892 1:230425914-230425936 GCCGCCCTCGGCCATGGCCCCGG No data
923055883_923055892 -5 Left 923055883 1:230425896-230425918 CCTCCTCCGCGCGCCCCCGCCGC No data
Right 923055892 1:230425914-230425936 GCCGCCCTCGGCCATGGCCCCGG No data
923055881_923055892 2 Left 923055881 1:230425889-230425911 CCGGCGCCCTCCTCCGCGCGCCC No data
Right 923055892 1:230425914-230425936 GCCGCCCTCGGCCATGGCCCCGG No data
923055882_923055892 -4 Left 923055882 1:230425895-230425917 CCCTCCTCCGCGCGCCCCCGCCG No data
Right 923055892 1:230425914-230425936 GCCGCCCTCGGCCATGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923055892 Original CRISPR GCCGCCCTCGGCCATGGCCC CGG Intergenic