ID: 923055982

View in Genome Browser
Species Human (GRCh38)
Location 1:230426156-230426178
Sequence GCCGCGCGCGGGGCTGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 1, 2: 0, 3: 30, 4: 389}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923055966_923055982 23 Left 923055966 1:230426110-230426132 CCTCGGAGCTCGGGCGCCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 119
Right 923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG 0: 1
1: 1
2: 0
3: 30
4: 389
923055965_923055982 24 Left 923055965 1:230426109-230426131 CCCTCGGAGCTCGGGCGCCGCAG 0: 1
1: 0
2: 0
3: 5
4: 57
Right 923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG 0: 1
1: 1
2: 0
3: 30
4: 389
923055971_923055982 7 Left 923055971 1:230426126-230426148 CCGCAGGCTGCGGGCCGCGGCGG 0: 1
1: 0
2: 4
3: 24
4: 237
Right 923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG 0: 1
1: 1
2: 0
3: 30
4: 389
923055975_923055982 -7 Left 923055975 1:230426140-230426162 CCGCGGCGGGAGGCGAGCCGCGC 0: 1
1: 0
2: 2
3: 18
4: 149
Right 923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG 0: 1
1: 1
2: 0
3: 30
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923055982 Original CRISPR GCCGCGCGCGGGGCTGGCAG GGG Intergenic
900368329 1:2320493-2320515 GCCCAGCGCTGGGCGGGCAGAGG + Intergenic
900393467 1:2443694-2443716 TCCCGGCGCGGGGCGGGCAGGGG + Intronic
900592933 1:3467894-3467916 GCCGTGGGCGTGGCGGGCAGCGG + Intronic
901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG + Exonic
901066595 1:6497338-6497360 GCCGCGCGGGGGGCGGGCGGCGG + Intronic
901447254 1:9316140-9316162 GCCTTGCCCTGGGCTGGCAGGGG + Intronic
901634386 1:10663835-10663857 GTGGAGAGCGGGGCTGGCAGAGG - Intronic
901713031 1:11130601-11130623 GCTGCCCTCGGTGCTGGCAGTGG + Exonic
902920723 1:19664941-19664963 GCCGCGGGCCGGGCGGGCGGCGG - Intergenic
902940984 1:19799973-19799995 GGCGCGCTCGGGGCAGGCGGCGG - Intergenic
903413784 1:23168148-23168170 GCCGCGGGCCGGGCGGGGAGGGG - Intronic
904719931 1:32500404-32500426 GCTGCGCGCAGCGCGGGCAGAGG + Intronic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
905580647 1:39081215-39081237 GCCGGGCGACGGACTGGCAGGGG + Intergenic
905774783 1:40661576-40661598 GCCGGGCCCAGGGCTGGCTGGGG - Intronic
905890541 1:41516110-41516132 GCCCAGCTCGGGGCTGGCCGGGG + Intronic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
907884036 1:58576982-58577004 CCAGCGCGCGGCACTGGCAGCGG + Exonic
908714263 1:67053650-67053672 GACGCGCGCGGCCCGGGCAGCGG - Intronic
908951592 1:69568318-69568340 GCGGCGCGCTGGGCAGGCTGAGG + Intergenic
913300785 1:117367111-117367133 GCCGCGCCTCGGGCGGGCAGAGG - Intergenic
914677877 1:149917789-149917811 GCCGCGGGCGGAGGCGGCAGCGG + Exonic
914803094 1:150974567-150974589 GCCCCGCGCGGGGGTGGGAAGGG - Intronic
914869144 1:151458878-151458900 GCCGCGCGAAGGGCCGGCGGCGG - Intronic
914937455 1:151993547-151993569 GCCGCGCCCGGGCCGGGGAGGGG + Intronic
915120489 1:153627292-153627314 GCGGCGGGTGGGGCTGGAAGAGG + Intronic
915333503 1:155127794-155127816 GCCGCGCGCCGGGCGGGGCGAGG + Exonic
915572290 1:156751248-156751270 GCTCCGCGCGGAGCGGGCAGAGG - Intronic
915595078 1:156892505-156892527 GCCGGAGGCGGGGCGGGCAGAGG + Intergenic
916170431 1:161997859-161997881 GCTCAGCGTGGGGCTGGCAGGGG + Exonic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
920380578 1:205532440-205532462 GCCGCCCTCTGGGGTGGCAGGGG - Intronic
920528741 1:206686155-206686177 GCCCCGCGCGGGCGTGGGAGGGG - Intronic
922739356 1:228006857-228006879 GGCCCGGGCGGGGCAGGCAGGGG - Intergenic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
923712118 1:236395830-236395852 GCCGCTCGCGGGGCTGGACTGGG - Intronic
924561119 1:245156688-245156710 GCGCCGCGCGGGGCTGGCTGGGG + Intronic
924775292 1:247111733-247111755 ACCGCGCGCGGTGCGGGGAGCGG + Exonic
1062843814 10:689789-689811 AGCGCGCGCGGGGCGGGCCGGGG - Intergenic
1063200996 10:3785313-3785335 GCCGCGCACGGGGCGGGCGCGGG - Intergenic
1064176489 10:13079810-13079832 GCAGCGTGGGTGGCTGGCAGAGG + Intronic
1064552920 10:16520916-16520938 GCCGCGGTCGGGCGTGGCAGCGG + Exonic
1064583561 10:16817456-16817478 GTCGGGCGTGGAGCTGGCAGCGG - Intronic
1065099563 10:22320735-22320757 GCAGCCCGCGGGGCCGGCCGGGG + Intronic
1065390206 10:25175175-25175197 GCTGCGCGAGGGGCCGGCTGGGG - Exonic
1065527518 10:26638087-26638109 GCCCCGCTTGGGGCTGGCATTGG - Intergenic
1065554851 10:26905485-26905507 GCCCCGCTCTGGGCTGGCTGAGG + Intergenic
1067336752 10:45373350-45373372 GCTGCCGGCGGGGCTGGGAGAGG + Intergenic
1068335891 10:55631424-55631446 GCACCGCGCGGGGAAGGCAGTGG - Intergenic
1069618755 10:69823451-69823473 GCCACACGCTGAGCTGGCAGAGG - Intronic
1070127569 10:73634525-73634547 CCCGCGGGCCAGGCTGGCAGAGG - Exonic
1070954304 10:80454350-80454372 CCCGCGCGCGGCGGCGGCAGCGG - Exonic
1071997678 10:91163323-91163345 GCCGGGCGCCGGGCGGGCAAGGG + Intronic
1073489606 10:103844323-103844345 GCCTGGCATGGGGCTGGCAGTGG - Intronic
1074591835 10:114821626-114821648 GCCTCGCGCGGGGCTGGAGGCGG - Intergenic
1075664441 10:124220701-124220723 GCTGGGTGCAGGGCTGGCAGAGG - Intergenic
1076850130 10:133088559-133088581 GCTGCGCCTGGGGCTGGCGGAGG - Intronic
1077177540 11:1197559-1197581 GCCGGGCAGGGGGCAGGCAGGGG - Intronic
1077250919 11:1560329-1560351 GGGGCACGCGGGGCAGGCAGTGG - Intronic
1077261508 11:1623942-1623964 GCCTCGCGCAGGGCTGGTGGGGG - Intergenic
1077505743 11:2929370-2929392 GCCGAGCGCGGGACTGGGAGCGG + Exonic
1077610840 11:3642331-3642353 GCCGCACGCGGGGCCGGGAGCGG + Intergenic
1078377403 11:10808057-10808079 GCTGGGCGCCGGGCTGGCGGGGG - Intronic
1083303764 11:61752562-61752584 GGGGCGCGTGGGGCGGGCAGGGG + Intergenic
1083316319 11:61816774-61816796 GCCGCGCGCCGGGCCAGCAGGGG + Exonic
1083476995 11:62921316-62921338 GCTGCGCCCTGTGCTGGCAGCGG + Exonic
1083639636 11:64138576-64138598 GCCGCGGGCCCTGCTGGCAGAGG + Intronic
1084070122 11:66728320-66728342 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1084151312 11:67289197-67289219 GCCGCGCGCTGGCCTGGCCGCGG + Intronic
1084169098 11:67391942-67391964 GGCGGGGGCGGGGCCGGCAGGGG + Exonic
1084430025 11:69105883-69105905 GCTGAGCCCCGGGCTGGCAGAGG - Intergenic
1084527240 11:69704811-69704833 GGCGAGCGCGGAGCAGGCAGGGG - Intergenic
1084546651 11:69818188-69818210 GCCGCGAGCGGGGAGGGCGGAGG + Intronic
1085353448 11:75815441-75815463 GCCGGGCCCGGGGGTGGCTGGGG - Exonic
1085445932 11:76600518-76600540 GCTGGGAGCGGGGCTGGCATGGG + Intergenic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1090229135 11:125089271-125089293 GCAGCGAGCGAGGCTGGCATGGG + Intronic
1090362338 11:126182263-126182285 GCCTCCCGAGAGGCTGGCAGTGG + Intergenic
1090780353 11:130002127-130002149 GCCGGGCGCCGGGCTGGGGGTGG - Intronic
1090780429 11:130002339-130002361 GCTGCGCGCGGCGAAGGCAGGGG + Intronic
1091207715 11:133832920-133832942 GACGGGCGCTGGGCTGGGAGGGG + Intergenic
1091266544 11:134276298-134276320 GCCGCGCGCGCGACTGGAAACGG - Intronic
1092861908 12:12725666-12725688 GCGGCGCGCGAGGCGGGGAGGGG - Intergenic
1095958536 12:47819724-47819746 GCCGCGCGCAGGGCGGGGCGGGG + Intronic
1096241336 12:49961808-49961830 GCCGGGCGCGGGGCCGGCGCGGG - Intergenic
1096337058 12:50764411-50764433 GTCGCGCGCGGTGGTGGCGGTGG + Intronic
1096465694 12:51847028-51847050 GCCGCGCGAGCTGCGGGCAGGGG - Intergenic
1096503576 12:52079872-52079894 GCCGCGCGCGGTGCAGGCGGTGG + Intergenic
1096580733 12:52583062-52583084 GCCCCTCGCGGAGCTGCCAGTGG - Intergenic
1096660817 12:53122998-53123020 GCCGGGCGGGGGGCTGGAGGTGG + Intronic
1100539884 12:95548331-95548353 GGTGGGCGCGGGGCTGGCACGGG - Intronic
1102948441 12:117011004-117011026 GGGGCGCCCGGGGCTGGCACAGG - Intronic
1103363930 12:120369097-120369119 GCCGCGGGCGGCGCGGGCAGCGG + Exonic
1103547501 12:121712659-121712681 GCCGCACGCGGGGCGGGGCGGGG + Intergenic
1104857578 12:131909308-131909330 GGCGCGGGCAGGGCTCGCAGGGG - Intronic
1104980132 12:132570022-132570044 ATGGGGCGCGGGGCTGGCAGTGG - Exonic
1105705493 13:22965482-22965504 GCTGAGCGCTGGGCTGACAGCGG - Intergenic
1105777686 13:23678225-23678247 GCCCCTCTCTGGGCTGGCAGAGG - Intergenic
1106125195 13:26895475-26895497 GCCGTGGGCCGGGCTGGGAGAGG + Intergenic
1107549035 13:41457951-41457973 GGCGCGCGCGGAGCTGGTGGTGG - Intronic
1107605218 13:42049169-42049191 GGCGCGGGCGGGGCGGGGAGGGG + Intronic
1107624866 13:42272099-42272121 GCGGGCCGCGGGGCTGGGAGGGG + Intergenic
1108229312 13:48320027-48320049 GCACAGCCCGGGGCTGGCAGGGG - Intronic
1109416501 13:62046960-62046982 GCCCCTCTCTGGGCTGGCAGAGG - Intergenic
1113656920 13:112073115-112073137 GCCGCGCGCGGGCCTCGGCGGGG - Intergenic
1115474535 14:33800543-33800565 GCCGAGAGCGGGGGTGACAGCGG - Exonic
1116657975 14:47675002-47675024 GCGGCGCGCTGGGCCGGCGGCGG + Intergenic
1116817620 14:49598702-49598724 CCCGAGCGCGCAGCTGGCAGCGG - Exonic
1117092796 14:52267720-52267742 GCCGCGCGCGGAGCTGCCGGGGG + Exonic
1120881302 14:89417026-89417048 GCCGCGGGCGCGGGCGGCAGGGG + Intronic
1122388465 14:101364616-101364638 GCAGCGCGCAGACCTGGCAGAGG - Intergenic
1122620952 14:103057445-103057467 GCCGCGGGCGGGGCTGAGGGCGG - Exonic
1122684196 14:103491885-103491907 GCCGTTCCCGGGGCTGGCCGTGG - Exonic
1122904547 14:104795759-104795781 GGCGGGCGCGGGGCGGGGAGAGG - Intergenic
1123004452 14:105314678-105314700 GGCGCGCGCGGGGCGGCCGGGGG + Exonic
1123215144 14:106802622-106802644 GGGGCGCGCGGGGCTACCAGGGG - Intergenic
1124427056 15:29570980-29571002 GGAGCGCGCGGGGCGGGCGGGGG - Intergenic
1124628867 15:31326253-31326275 GCCGGGCGCGGGGCTGCCTAGGG - Intergenic
1126150890 15:45522789-45522811 GCCTCGCGCAGGGCGGGGAGAGG - Exonic
1127686200 15:61347406-61347428 GGCGGGCGGGGGGCTGGCAGAGG + Intergenic
1128344122 15:66842802-66842824 GCCGCGCGCAGGGCAGGGGGCGG + Intergenic
1128866032 15:71115724-71115746 GCCGCGCGGGCGGCGCGCAGGGG - Intronic
1129189149 15:73927461-73927483 AGCGCGCCCGGGGCTGGTAGGGG - Exonic
1129644723 15:77419777-77419799 GCGGGGCGCGGGGGTGGCCGGGG + Intronic
1129986463 15:79923498-79923520 GCCGCGGGCGGCGGAGGCAGCGG - Exonic
1130032850 15:80332064-80332086 GCCCCGCACCGGGCTGGCACTGG - Intergenic
1131400778 15:92124041-92124063 GCTGCAGGAGGGGCTGGCAGTGG + Intronic
1132585956 16:705833-705855 GGCGCGCGCGGCGCCGGCGGCGG - Intronic
1132634799 16:938429-938451 GCAGCTCGTGGGGATGGCAGGGG + Intronic
1132683445 16:1153016-1153038 GCCGGGGGCGGGGCGGGCGGGGG - Intergenic
1132724686 16:1333650-1333672 TCGGCGCGCGCGGCTGGGAGCGG + Intronic
1132875652 16:2135777-2135799 GGCGGGCGCGGGGCTGGATGGGG + Exonic
1133115173 16:3574422-3574444 GACCCGAGCGGGGCTGGGAGAGG + Intronic
1134070323 16:11256274-11256296 GCTGGGGGCGGGGCCGGCAGGGG - Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134519333 16:14911576-14911598 GGCGGGCGCGGGGCTGGATGGGG - Intronic
1134554599 16:15154652-15154674 GGCGGGCGCGGGGCTGGATGGGG + Intergenic
1134707003 16:16310231-16310253 GGCGGGCGCGGGGCTGGATGGGG - Intergenic
1134960537 16:18401893-18401915 GGCGGGCGCGGGGCTGGATGGGG + Intergenic
1135564420 16:23500505-23500527 GCCCCGCTTGGGGCTGGCATTGG - Intronic
1136261824 16:29082400-29082422 GCCGGGCGCGGCGCTGGGAAGGG - Intergenic
1136375540 16:29863099-29863121 AGCGCCTGCGGGGCTGGCAGAGG - Exonic
1136787730 16:32945718-32945740 GCCGTGGGCTGGGCTGGCATGGG + Intergenic
1136882051 16:33908071-33908093 GCCGTGGGCTGGGCTGGCATGGG - Intergenic
1137767758 16:50991207-50991229 GCCGAGCGCCAGGCTGGCTGAGG + Intergenic
1138105878 16:54286938-54286960 CCCGCGCGCGGGGCGGGGCGGGG + Intergenic
1138591363 16:58001085-58001107 GCCGGGCTCGGGGCAGGCAGGGG + Intronic
1138649548 16:58451542-58451564 GCAGAGAGTGGGGCTGGCAGGGG + Intergenic
1139451230 16:67029358-67029380 GCCGCGCTCGGGGCTTGCGCGGG - Exonic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1140222945 16:73057710-73057732 GGCGCTCGCGGCGCTGCCAGTGG + Intronic
1141174048 16:81707799-81707821 GGAGCGGGCGGGACTGGCAGAGG + Intronic
1141677978 16:85527579-85527601 GCCCCGGGAGGGGCTTGCAGCGG + Intergenic
1203089959 16_KI270728v1_random:1207375-1207397 GCTGCGGGCTGGGCTGGCATGGG + Intergenic
1142763871 17:2055503-2055525 CTGGCGGGCGGGGCTGGCAGGGG + Intronic
1142876061 17:2852924-2852946 GGCTCGCGCGCGGCTGGCAGGGG + Intronic
1143201471 17:5116294-5116316 GCCGGGAGCGGGGCCGGGAGTGG - Intronic
1143202677 17:5123129-5123151 GCAGCGGCCGGCGCTGGCAGTGG + Intronic
1143514760 17:7414122-7414144 GCCGCGGGGAAGGCTGGCAGAGG + Intronic
1143554459 17:7651749-7651771 GCCGGGCTCTGGGCTGGGAGGGG + Intronic
1143596248 17:7916008-7916030 GCGGCGCGCGGGGACGGCGGCGG - Intergenic
1145828271 17:27893424-27893446 GTCCCGCGCGCGGCCGGCAGAGG - Intronic
1147044469 17:37743081-37743103 GCCCGGCGCGGGGCTGGGTGCGG + Intronic
1147148085 17:38497836-38497858 GCCGCGGGCTGGGCTGGCATGGG + Intronic
1147315487 17:39618169-39618191 GCCGCGCGCCGGGCGGGGCGGGG + Intergenic
1147423001 17:40331881-40331903 GCCGGGGGTGGAGCTGGCAGGGG - Intronic
1148664062 17:49361816-49361838 GCCGCCCGCGGGGCCGGCCCGGG - Intronic
1148911364 17:50944760-50944782 GCCTCCCGCGGGGCGGGCGGGGG - Intergenic
1149849323 17:60026015-60026037 GCGGCGGCCGGCGCTGGCAGTGG - Intergenic
1149860845 17:60120509-60120531 GCGGCGGCCGGCGCTGGCAGTGG + Intergenic
1150489041 17:65561772-65561794 GGGCCGCGGGGGGCTGGCAGGGG - Intronic
1151453559 17:74213504-74213526 GCCGGGGGCGGGGCGGGCACGGG + Exonic
1152433320 17:80261066-80261088 GCCGCGGGCGGGGCTGGACCGGG - Intronic
1152563230 17:81089042-81089064 GCAGCGCGGAGGGCAGGCAGAGG - Intronic
1152648521 17:81481462-81481484 GCGGCGCGAGGGGCTGTTAGAGG - Intergenic
1152677322 17:81648269-81648291 GCCCCGGGCGGGCTTGGCAGCGG - Exonic
1152708794 17:81860107-81860129 GCCGTGCGCAGGGCGGGCATCGG + Intronic
1152912613 17:83013701-83013723 GCCCCGCGGGGGGAGGGCAGAGG + Intronic
1153051987 18:908416-908438 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1153565676 18:6414962-6414984 CATGCGCGCGGGGCGGGCAGGGG - Intronic
1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG + Intronic
1160163346 18:76491611-76491633 GCCGTGGGCGGGGCGGGAAGGGG - Intronic
1160613949 18:80109698-80109720 GCGGCGGGCGGGGCGGGCCGCGG - Intronic
1160715007 19:572578-572600 GCCGCGGGCGGCGGCGGCAGCGG + Exonic
1160738708 19:676330-676352 GCCGCGGGCGGGGCGGGGCGCGG - Intergenic
1160864398 19:1250596-1250618 GCGCCGCGCGGGGAAGGCAGGGG + Intronic
1160908305 19:1462211-1462233 GCTGCGCTCGGGGCGGGCACAGG + Intronic
1160909210 19:1467194-1467216 GCCGCGCTCGGGGCAGGCCGAGG - Exonic
1160947954 19:1652218-1652240 AGCGCGCGCGGGGCGGGCCGGGG + Intronic
1160999951 19:1905565-1905587 GACGCGCGCGAGGCTGGCCTGGG - Intronic
1161030558 19:2056152-2056174 GCAGGGGGCGAGGCTGGCAGGGG - Intergenic
1161150083 19:2702816-2702838 GCGGGGCGCGGGGCAGGCAGCGG + Intergenic
1161203616 19:3029119-3029141 GGGGCGAGCGGGGCGGGCAGGGG + Exonic
1161702936 19:5804997-5805019 GCCGGGGGCGGGGCTGGGGGCGG - Intergenic
1162101684 19:8342891-8342913 CCAGCGCGAGGGGCTGGCTGGGG + Intronic
1162769997 19:12943658-12943680 GGGGCGGGCAGGGCTGGCAGGGG + Intronic
1162777845 19:12990438-12990460 GCCCCGTGGGGGGCTGGGAGCGG - Intergenic
1163023434 19:14495894-14495916 GCTGCGCGCGGGGATGCCGGAGG - Intronic
1163243178 19:16076642-16076664 ACCGCGCGCAGGGCCTGCAGCGG + Intronic
1163426985 19:17245443-17245465 GCCGGGCCCGGGGCCGGGAGGGG + Exonic
1163720577 19:18896388-18896410 GGGGCGCGCGGGGCAGGCATGGG - Intronic
1164693515 19:30227439-30227461 GCCCCGCGTGCGGGTGGCAGCGG + Intergenic
1165123857 19:33580551-33580573 GGCTCGCCAGGGGCTGGCAGGGG + Intergenic
1165157217 19:33796038-33796060 GCGGCGCCCGGGGCTGGGGGCGG - Intronic
1165349865 19:35269512-35269534 GCCGCGCCCGGGGAGGGCTGGGG + Intronic
1165742359 19:38211589-38211611 GCCCGGCGGGGGGCCGGCAGAGG + Intronic
1166219077 19:41353775-41353797 GCCGCCCGCGGGGCCGGCCTCGG - Exonic
1166369936 19:42295010-42295032 GCCCCCTGCGGGGCTGGGAGTGG - Exonic
1166630441 19:44401647-44401669 GCTGCGCGCGGGGCTTTCTGGGG - Intergenic
1167037754 19:47004093-47004115 GCCGCGCGGGGGGCTGGGTCTGG + Exonic
1167112783 19:47471815-47471837 CCCCAGCGCTGGGCTGGCAGTGG + Exonic
1167333127 19:48868630-48868652 GCAGCGTGGGCGGCTGGCAGAGG - Exonic
1167455692 19:49595909-49595931 GCTGAGCGAGGGGCTGGCTGTGG - Exonic
1167577081 19:50323019-50323041 GGCTCGCCGGGGGCTGGCAGAGG + Exonic
1167577693 19:50325667-50325689 GCCGCGCGCCCGGCTCGGAGGGG - Intronic
1167578310 19:50328251-50328273 CCCACACGCGGGGCTGCCAGCGG + Exonic
1168317427 19:55490288-55490310 GCTGGGCGGGGGGCTGGGAGTGG - Exonic
1168408033 19:56120911-56120933 GCGGCGAGCGGGGCTGGAGGGGG - Intronic
1168718973 19:58544596-58544618 GTCCCGCGCGCGGCGGGCAGCGG + Exonic
924977530 2:191764-191786 GCCCCTCTCTGGGCTGGCAGAGG - Intergenic
925609463 2:5691846-5691868 GCCCCGCGAGGGGCTCGCCGGGG + Intergenic
925927203 2:8678983-8679005 GCGGCGCGCGGGCCAGGCCGCGG - Exonic
926171497 2:10555726-10555748 GCCTCCCGTGGGGCAGGCAGAGG + Intergenic
926801837 2:16665908-16665930 GCCGCGAGCCGGGCTGGGGGCGG - Intronic
927230888 2:20823151-20823173 GCCGCGCGCCAGGCTGACATCGG - Intergenic
927544425 2:23940384-23940406 GCCGAGGGCGGGGCTTGCCGCGG - Intronic
927667353 2:25041988-25042010 GCGGGGCGAGGGGCTCGCAGAGG + Intergenic
927956673 2:27211983-27212005 ACGGCGAGCGGGGCGGGCAGGGG - Intronic
932611451 2:73202991-73203013 GCCACGCGCGGCCCTGGCACAGG - Exonic
932722390 2:74147699-74147721 GGCGCGCGCGGCACTGGCAATGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934534536 2:95121980-95122002 GGCGCCCGCGGGGCTGTCCGCGG - Exonic
934966823 2:98731002-98731024 GCGGCGCGCGGGGGCGGGAGGGG - Intronic
937894951 2:126971583-126971605 GGCCCTCCCGGGGCTGGCAGTGG - Intergenic
937950838 2:127387344-127387366 GCCGGGAGGGGGGCTGGCGGCGG - Intronic
939178665 2:138780439-138780461 GGCGCGCGGGGGGCCGGGAGAGG - Intergenic
939886486 2:147686664-147686686 GCCCCTCTCTGGGCTGGCAGAGG - Intergenic
942034726 2:171999832-171999854 TGCGCGCGCGGGGCTGACTGCGG - Exonic
942678190 2:178450742-178450764 GCGGCGCGCGGGGCGGGCGGAGG - Intronic
943669848 2:190649022-190649044 AGCGCGCGCGGGGAAGGCAGGGG + Intronic
946875565 2:224126220-224126242 GCCGAGGGCGTGGCTGGCTGAGG + Intergenic
947739841 2:232480054-232480076 GCCCAGAGCGGGGCTGGCACCGG + Exonic
947741754 2:232487907-232487929 GGGGCGCGCGGGGCGGGCGGAGG - Intergenic
947860454 2:233354376-233354398 GCTGCGCGCATGGCCGGCAGGGG + Intergenic
948645301 2:239400631-239400653 GCGGGGCGCGGGGCGGGCGGCGG + Exonic
948909554 2:240996265-240996287 GCCTGGGGCGTGGCTGGCAGTGG - Intergenic
1169164113 20:3407680-3407702 GCGGCGCGCGGGCCCGGCGGGGG + Intergenic
1169327433 20:4686909-4686931 GCAGGGCGCGGGGCGGGGAGGGG + Intronic
1169557811 20:6768415-6768437 GCCCCGCGCGGGGCCGGCTCCGG - Exonic
1170890040 20:20368700-20368722 GGCGCGAGCGGAGCTGGCGGAGG + Exonic
1171011357 20:21510924-21510946 GCCGCCCGCGGGGCTCCCACAGG - Intergenic
1171209141 20:23303567-23303589 TCCCCCCGCGGGGCTGGCTGAGG + Intergenic
1171790071 20:29515024-29515046 GCCTCGCTTGGGGCTGGCATTGG - Intergenic
1171857638 20:30361821-30361843 GCCTCGCTTGGGGCTGGCATTGG + Intergenic
1172793438 20:37521535-37521557 GGGGCGCGCGGTGCCGGCAGCGG - Intronic
1173752374 20:45487475-45487497 GCGGCTGGCGGGGGTGGCAGTGG - Intergenic
1174386476 20:50190841-50190863 GCCGCGCACGGGACTGGGAAGGG + Exonic
1175715928 20:61253824-61253846 GCAGCGCGCGGAGCTGGAGGAGG + Intronic
1176039472 20:63056636-63056658 GGGGCTGGCGGGGCTGGCAGTGG + Intergenic
1176077403 20:63254623-63254645 GCCGCAGGCGGGGGTGGGAGGGG - Intronic
1176238959 20:64067170-64067192 GCCCAGCTTGGGGCTGGCAGTGG + Intronic
1176242136 20:64080045-64080067 GCCGAGCGCGGGGCGGGGCGCGG - Intergenic
1176549514 21:8215028-8215050 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1176557405 21:8259257-8259279 GCCGCGCGCGGGTCGGTTAGCGG + Intergenic
1176568439 21:8398062-8398084 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1176576351 21:8442292-8442314 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1178948477 21:36966868-36966890 GCCGCGCCCAGGGCTGGTGGCGG + Intronic
1179209530 21:39313493-39313515 GCCGGGCGCGGGGCGGGAGGCGG + Exonic
1179783876 21:43719073-43719095 GCGGCGCCGGGGGCTGGCCGGGG - Intronic
1179788211 21:43741355-43741377 GGCTCGCGGGGGGCTGGCGGGGG + Intronic
1179882663 21:44300025-44300047 GGCGCGCGCGGGGCGGGGCGGGG + Intergenic
1179987022 21:44927715-44927737 GCTGCAGGCAGGGCTGGCAGAGG + Intronic
1180064324 21:45405114-45405136 GCCGGGCAGGGGGCGGGCAGGGG - Intergenic
1180235734 21:46458567-46458589 GCCGCGCGCGGGGCCACCAGCGG + Intergenic
1180390772 22:12280145-12280167 GCCTCGCTTGGGGCTGGCATCGG - Intergenic
1180959239 22:19755249-19755271 ACCGCGGGCGGGGGTGGCGGGGG - Intergenic
1182289829 22:29268556-29268578 GGCGCGCGGGGGGCTTGCTGCGG + Intronic
1182522864 22:30893999-30894021 GCCGTGAGTAGGGCTGGCAGGGG + Exonic
1184247560 22:43243339-43243361 GCCAGGCGCAGGGCTGGCTGGGG + Intronic
1184262847 22:43329247-43329269 TCTGCCCGCAGGGCTGGCAGTGG + Intronic
1184361975 22:44024315-44024337 GCCGCGCGTGGGGCCGGCGGCGG - Intronic
1184523796 22:45009847-45009869 GGCGCGCGCGGGGCTGCGCGGGG - Intronic
1184749172 22:46474355-46474377 GCAGCCCGAGGGGATGGCAGTGG - Intronic
1184791867 22:46705091-46705113 GCCACCCACGGGGCTGGGAGGGG - Intronic
1185056477 22:48581303-48581325 GCCGAGGGCCAGGCTGGCAGTGG + Intronic
1185259520 22:49853820-49853842 GCCGCGCGGGGCCCTGGGAGGGG + Exonic
1185313837 22:50170466-50170488 GCCGGGCGCGGAGCCCGCAGCGG - Intergenic
1185313868 22:50170557-50170579 GCCGCGGGAGAGGGTGGCAGGGG - Intergenic
1203254401 22_KI270733v1_random:131350-131372 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1203262457 22_KI270733v1_random:176429-176451 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
950153736 3:10707683-10707705 GCGGCGGGCGGGGCGGGCCGGGG - Intronic
950161752 3:10765629-10765651 GCGGGGGGAGGGGCTGGCAGGGG - Intergenic
950502491 3:13373181-13373203 GCCACAGGTGGGGCTGGCAGAGG + Intronic
950729926 3:14948071-14948093 GCCGCGGGCGGGGAGGGGAGGGG - Intronic
952076263 3:29701516-29701538 GCCCCTCTCTGGGCTGGCAGAGG + Intronic
952484767 3:33798937-33798959 GGTGGGCGCGGGGCTGGGAGTGG + Exonic
953326070 3:42013561-42013583 GCGGCGGGCGGGGCTGGGAAGGG + Intergenic
953881529 3:46693709-46693731 GCAGGGGGCGGGACTGGCAGGGG - Intergenic
953881536 3:46693725-46693747 GAAGGGGGCGGGGCTGGCAGGGG - Intergenic
953910167 3:46888836-46888858 GCCGCCTTCGGGGCAGGCAGTGG - Intronic
954375965 3:50194288-50194310 ACCGCGCGCTGGGCTGGGGGAGG + Intronic
954397334 3:50299657-50299679 GCCTGGGGCGGGGCTGGCGGAGG - Intergenic
958936394 3:100260744-100260766 GCCGCGGGCGGGGCGGGGCGCGG - Intergenic
960096747 3:113696659-113696681 GCCGCGGGAGGGGCGGGGAGGGG - Intergenic
960848003 3:122022281-122022303 GCGGCGCGCGGGGCGGGAGGCGG - Intergenic
961182505 3:124887448-124887470 GCCGGGCGAGGGCCTGGCAGGGG - Intronic
961427465 3:126859266-126859288 GCCGCATGCAGGGCTGGTAGTGG + Intronic
962804202 3:138915569-138915591 GGCGCGCTCGGGGCCGCCAGGGG - Intergenic
965519996 3:169662223-169662245 GCTCCGCGCCGGGCAGGCAGGGG + Intronic
966721232 3:183064506-183064528 GGCGCGCGGGGTGCAGGCAGGGG - Intronic
967840787 3:194003215-194003237 CCCGCGGGCGGGGCAGGAAGGGG + Intergenic
967904071 3:194486699-194486721 GCAGCGCGCGGCGCCGGCCGAGG - Intronic
968136038 3:196220153-196220175 GCTGCGCGCCGGGCTGGCGGAGG + Intronic
968701495 4:2060022-2060044 GCCCCGCGCAGGGCTGGCTATGG + Intronic
969016557 4:4107478-4107500 GCTGCGGGAAGGGCTGGCAGTGG + Intergenic
978795697 4:112705836-112705858 GCCGGGCGCGGCGCTGGGAAGGG + Intergenic
981128616 4:141133390-141133412 GCCGCGGGCGGGGCGGGCTTGGG + Intronic
983296625 4:165874844-165874866 CGCGCGCGAGAGGCTGGCAGCGG - Intronic
983537863 4:168877790-168877812 GCGCTGCGCGGGGCTGGCGGAGG - Intronic
984908294 4:184649505-184649527 GCGGCGCGAGGGGCCGACAGGGG - Intronic
985434683 4:189917256-189917278 GCCCCGCTTGGGGCTGGCATTGG + Intergenic
986152471 5:5140244-5140266 GGAGAGCGCGGGGCGGGCAGGGG - Intergenic
986402769 5:7395995-7396017 GCTGCGCGCGGGGCGGGGAGCGG + Intergenic
987132575 5:14872293-14872315 GCGGGGCGCGGGGCTGGGAAGGG + Intergenic
988777524 5:34490776-34490798 GCAGGGGGCGGGGGTGGCAGGGG + Intergenic
989812609 5:45695991-45696013 GACGGGCGCGGGGCCGGCCGCGG - Exonic
992627578 5:78648924-78648946 GCGGCGCGCGGGGCGGGACGGGG + Intronic
994670246 5:102755099-102755121 GGCGAGCGCGGGGCTGGCCCGGG + Intronic
995650462 5:114362633-114362655 GCTGCCCGTGGGGCTGGCGGCGG - Exonic
997013599 5:129905386-129905408 GCCGCGCGCTGGCCGCGCAGCGG + Exonic
997470492 5:134114658-134114680 GCCGGGGGCGGGGCGGGCACTGG - Intergenic
998200378 5:140113899-140113921 GGCGGACGGGGGGCTGGCAGCGG + Intronic
998374479 5:141681952-141681974 GGCGGGGGCGGGGCGGGCAGTGG + Intronic
999395455 5:151224040-151224062 GGCGGGCGCGGAGCGGGCAGCGG - Exonic
1001506529 5:172284159-172284181 GCTGCGGGCGGGGCTGCGAGCGG + Intergenic
1002159691 5:177307859-177307881 GCAGCTCCGGGGGCTGGCAGGGG - Exonic
1002424488 5:179167233-179167255 CCCCCGCGCGGGGCGGGCAGAGG + Intronic
1002512764 5:179733393-179733415 GCCGTGCTCGGGGCCGTCAGCGG - Exonic
1002645211 5:180649440-180649462 CCCGAGCGTGGGGCTGGCCGGGG - Intronic
1003049244 6:2765407-2765429 GCCGCGTGAGGCGCTGCCAGCGG + Exonic
1006614690 6:35318411-35318433 GCAGCTCGCGGTGCTGGCTGCGG - Exonic
1007666542 6:43516835-43516857 TCCGCGCGCGGGGCTAGCGCGGG - Exonic
1007785105 6:44275378-44275400 GCGGCGCGGGGGGCAGGCGGCGG - Intronic
1007785384 6:44276624-44276646 GCCGCGCGGGGGGCAGGGAAAGG + Exonic
1008545174 6:52577268-52577290 GCCGGGCGCGGCGCTGGCGCGGG - Intergenic
1014632531 6:123803908-123803930 GGCGCGCTCGGGGCCCGCAGGGG - Intergenic
1015226615 6:130864441-130864463 GCTGCGAGCGGGGCTGGAGGAGG + Intronic
1015496660 6:133889913-133889935 AGTGCGCGCGGGGCTGGGAGTGG + Intronic
1017174986 6:151494204-151494226 GCCGCGCGCGGGGGTGGCCCTGG + Intronic
1018046205 6:159968924-159968946 GCAGCGCGCGGGACAGGAAGCGG - Intergenic
1018778995 6:167045350-167045372 GCCGCGGGGGGGGCGGGGAGGGG - Exonic
1019343584 7:519517-519539 GGCGAGCGCGGGGCCGGCGGTGG - Intronic
1019562207 7:1664717-1664739 GAGGGGCGCGGCGCTGGCAGCGG + Intergenic
1020120590 7:5501035-5501057 GCCGGGCCAGGAGCTGGCAGAGG + Exonic
1021510503 7:21428003-21428025 GCGGCGCGCGGCGCGGGCGGCGG - Intergenic
1021828007 7:24573635-24573657 GCCGCGCGCCGGGCCGGCCGGGG + Intronic
1021998366 7:26201706-26201728 GCTGCGCGCGGGGCCGCCGGGGG - Intronic
1022528334 7:31052385-31052407 GCGCCGCGCGGGGCGGGCAAAGG + Intergenic
1023000311 7:35801405-35801427 GCCGCGCCCCGGGCCCGCAGTGG - Intronic
1024471835 7:49774074-49774096 GCCGGACGCCGGGCTCGCAGCGG - Exonic
1024520948 7:50304035-50304057 GGTGCGCGCGGGGGTGGCGGCGG + Intergenic
1026048060 7:66921506-66921528 GCTGCCCGCGGGGCCGGGAGCGG + Intronic
1028231060 7:88306842-88306864 GCCGCGGGCCGGGCGGGTAGAGG + Exonic
1028709379 7:93890462-93890484 GCCGCGCGCTCCGCTGGCAGGGG - Intronic
1028792845 7:94873265-94873287 ACCGTGCTCTGGGCTGGCAGTGG + Intergenic
1029080755 7:97972223-97972245 GCGGCGGCCGGGGCTGGGAGCGG - Intergenic
1029238818 7:99144105-99144127 GGCGCGCGCGCGGCTCGGAGAGG - Intergenic
1029372491 7:100158427-100158449 GCCGCGCGCGGAGCTGGCAGGGG - Exonic
1029456678 7:100675378-100675400 GCCGCGGGTGGGGGTGACAGCGG - Intronic
1029629806 7:101743304-101743326 TCCACGCGCGCGCCTGGCAGGGG + Intergenic
1031732187 7:125313256-125313278 GCAGCGCAAGTGGCTGGCAGAGG + Intergenic
1032020710 7:128405971-128405993 GCCGCGGGCCGGGCGGGCCGGGG + Intronic
1032125366 7:129189156-129189178 CCCCCGCGCTGGGCGGGCAGCGG - Exonic
1032781944 7:135170717-135170739 GGAGCGCGCGGGGCCGGAAGAGG - Intronic
1033120774 7:138664899-138664921 GTCGAGCGCGGGGCTGGTTGGGG - Intronic
1034228043 7:149497876-149497898 CCCGCGGGCGGGGCTGGGCGGGG - Intergenic
1034902597 7:154916554-154916576 GCCGAGTGGGGGGCAGGCAGGGG + Intergenic
1035404287 7:158587901-158587923 GGGGCGAGCGGGGCTGGCCGGGG - Intergenic
1036802437 8:11802641-11802663 GCCGCCAGCGGGGCTAGCTGCGG - Intronic
1037273788 8:17156669-17156691 GCCGCCCGCGGGCCTGGCTCCGG - Exonic
1037752665 8:21692836-21692858 GACCCGCTGGGGGCTGGCAGAGG - Exonic
1037753829 8:21699011-21699033 GCTGCGTGCGGGACTGGTAGAGG - Intronic
1037935264 8:22911328-22911350 GCTGGGGGCTGGGCTGGCAGGGG - Intronic
1044973723 8:97644147-97644169 GCCGCGCGCGGGGACGACCGTGG - Intergenic
1045489101 8:102655763-102655785 GCCGCGGGCGGGGGTGGGGGCGG + Exonic
1047393664 8:124474812-124474834 TCCGCGGGCGGGGGAGGCAGTGG + Exonic
1048009367 8:130443639-130443661 GCCGAGCGCGGCGCAGGAAGGGG + Exonic
1048345535 8:133572068-133572090 GCCGCGCGCAGGGGAGGCGGTGG - Intergenic
1049684595 8:143934230-143934252 GCCGGGGGCGGGGCGGGGAGGGG + Intronic
1049799071 8:144509444-144509466 GACGCGCGTGGGGCTGGCCAAGG + Exonic
1049828619 8:144685827-144685849 GCCGCGCACTGGGCCGGCGGCGG - Intergenic
1049879445 8:145052251-145052273 GGCGCGGGCGGGGCGGGGAGCGG - Intergenic
1051774518 9:20620555-20620577 GCGGCGCGGGGGGCGGGGAGCGG + Intronic
1052507884 9:29378450-29378472 GCAGCACAAGGGGCTGGCAGAGG + Intergenic
1053723738 9:40975329-40975351 GCCCCGCTTGGGGCTGGCATTGG + Intergenic
1054342222 9:63876670-63876692 GCCCCGCTTGGGGCTGGCATTGG - Intergenic
1057276232 9:93677253-93677275 GCAGCACGGGGTGCTGGCAGTGG + Intronic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1059769711 9:117414375-117414397 GCCCCGAGTGGGGTTGGCAGAGG - Intronic
1060661728 9:125408580-125408602 GCCGTGGGCGCGGCCGGCAGGGG + Intergenic
1060825110 9:126683297-126683319 GCCGCGGGCCGGGCGGGCGGCGG - Intronic
1061149063 9:128818717-128818739 GTCGGGCGCGGGGCTGGGTGCGG + Exonic
1061382316 9:130265856-130265878 GCCGAGCGCGGCTCTGGCTGCGG - Intergenic
1061679734 9:132237083-132237105 GCAGGGCGCGGGGGTGTCAGGGG + Intronic
1061923448 9:133794654-133794676 GCCCTGAGGGGGGCTGGCAGAGG + Intronic
1062190295 9:135244532-135244554 GCCTCACGCGGGGCGGGGAGTGG - Intergenic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1062365226 9:136205164-136205186 CGCGCGGGCGGGGCGGGCAGCGG - Intergenic
1062461953 9:136665919-136665941 GCCGCGCGCGGAGCTGGGGGCGG + Intronic
1062537898 9:137028807-137028829 GCCGTGAGCGGAGCAGGCAGGGG + Intronic
1203451421 Un_GL000219v1:120669-120691 GCCTCGCTTGGGGCTGGCATTGG - Intergenic
1203470802 Un_GL000220v1:114494-114516 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1203478623 Un_GL000220v1:158466-158488 GCCGCGCGCGGGTCGGGGGGCGG + Intergenic
1191250560 X:58258159-58258181 CCCCTGCGCAGGGCTGGCAGGGG + Intergenic
1192141038 X:68647464-68647486 GCAGGTGGCGGGGCTGGCAGGGG + Intergenic
1194340504 X:92699896-92699918 GCCCCTCTCTGGGCTGGCAGAGG - Intergenic
1199500401 X:148500756-148500778 GCCGCCCGCCTGGCTGGCTGCGG - Exonic
1199736785 X:150693302-150693324 GCGGCGCGCGGGGCCGGCGCCGG - Intronic
1200217533 X:154374679-154374701 GCCGGGCGCGGGGCGGGCGCGGG - Intergenic
1200229439 X:154436844-154436866 GGCGCGCGCGGGGCGGGGCGGGG + Intergenic
1200648859 Y:5816632-5816654 GCCCCTCTCTGGGCTGGCAGAGG - Intergenic