ID: 923055982

View in Genome Browser
Species Human (GRCh38)
Location 1:230426156-230426178
Sequence GCCGCGCGCGGGGCTGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923055971_923055982 7 Left 923055971 1:230426126-230426148 CCGCAGGCTGCGGGCCGCGGCGG No data
Right 923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG No data
923055965_923055982 24 Left 923055965 1:230426109-230426131 CCCTCGGAGCTCGGGCGCCGCAG No data
Right 923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG No data
923055966_923055982 23 Left 923055966 1:230426110-230426132 CCTCGGAGCTCGGGCGCCGCAGG No data
Right 923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG No data
923055975_923055982 -7 Left 923055975 1:230426140-230426162 CCGCGGCGGGAGGCGAGCCGCGC No data
Right 923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923055982 Original CRISPR GCCGCGCGCGGGGCTGGCAG GGG Intergenic