ID: 923057342

View in Genome Browser
Species Human (GRCh38)
Location 1:230436947-230436969
Sequence ATTTCAACACTGATTTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923057342_923057345 2 Left 923057342 1:230436947-230436969 CCAACATAAATCAGTGTTGAAAT No data
Right 923057345 1:230436972-230436994 AAAGATTGAGCTGGGCGCAGTGG No data
923057342_923057347 30 Left 923057342 1:230436947-230436969 CCAACATAAATCAGTGTTGAAAT No data
Right 923057347 1:230437000-230437022 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
923057342_923057343 -7 Left 923057342 1:230436947-230436969 CCAACATAAATCAGTGTTGAAAT No data
Right 923057343 1:230436963-230436985 TTGAAATATAAAGATTGAGCTGG No data
923057342_923057344 -6 Left 923057342 1:230436947-230436969 CCAACATAAATCAGTGTTGAAAT No data
Right 923057344 1:230436964-230436986 TGAAATATAAAGATTGAGCTGGG No data
923057342_923057346 29 Left 923057342 1:230436947-230436969 CCAACATAAATCAGTGTTGAAAT No data
Right 923057346 1:230436999-230437021 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923057342 Original CRISPR ATTTCAACACTGATTTATGT TGG (reversed) Intergenic
No off target data available for this crispr