ID: 923057567

View in Genome Browser
Species Human (GRCh38)
Location 1:230438675-230438697
Sequence AGGGCAGGTCTCTGTGTCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923057567_923057578 19 Left 923057567 1:230438675-230438697 CCGTAGACACAGAGACCTGCCCT No data
Right 923057578 1:230438717-230438739 GTCTTGTGCTCTGCGGTGGATGG No data
923057567_923057579 20 Left 923057567 1:230438675-230438697 CCGTAGACACAGAGACCTGCCCT No data
Right 923057579 1:230438718-230438740 TCTTGTGCTCTGCGGTGGATGGG No data
923057567_923057576 12 Left 923057567 1:230438675-230438697 CCGTAGACACAGAGACCTGCCCT No data
Right 923057576 1:230438710-230438732 GAGCTGGGTCTTGTGCTCTGCGG No data
923057567_923057572 -4 Left 923057567 1:230438675-230438697 CCGTAGACACAGAGACCTGCCCT No data
Right 923057572 1:230438694-230438716 CCCTCAGGAGTGCCTGGAGCTGG No data
923057567_923057574 -3 Left 923057567 1:230438675-230438697 CCGTAGACACAGAGACCTGCCCT No data
Right 923057574 1:230438695-230438717 CCTCAGGAGTGCCTGGAGCTGGG No data
923057567_923057569 -10 Left 923057567 1:230438675-230438697 CCGTAGACACAGAGACCTGCCCT No data
Right 923057569 1:230438688-230438710 GACCTGCCCTCAGGAGTGCCTGG No data
923057567_923057577 15 Left 923057567 1:230438675-230438697 CCGTAGACACAGAGACCTGCCCT No data
Right 923057577 1:230438713-230438735 CTGGGTCTTGTGCTCTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923057567 Original CRISPR AGGGCAGGTCTCTGTGTCTA CGG (reversed) Intergenic