ID: 923057573

View in Genome Browser
Species Human (GRCh38)
Location 1:230438695-230438717
Sequence CCCAGCTCCAGGCACTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923057573_923057578 -1 Left 923057573 1:230438695-230438717 CCTCAGGAGTGCCTGGAGCTGGG No data
Right 923057578 1:230438717-230438739 GTCTTGTGCTCTGCGGTGGATGG No data
923057573_923057579 0 Left 923057573 1:230438695-230438717 CCTCAGGAGTGCCTGGAGCTGGG No data
Right 923057579 1:230438718-230438740 TCTTGTGCTCTGCGGTGGATGGG No data
923057573_923057577 -5 Left 923057573 1:230438695-230438717 CCTCAGGAGTGCCTGGAGCTGGG No data
Right 923057577 1:230438713-230438735 CTGGGTCTTGTGCTCTGCGGTGG No data
923057573_923057576 -8 Left 923057573 1:230438695-230438717 CCTCAGGAGTGCCTGGAGCTGGG No data
Right 923057576 1:230438710-230438732 GAGCTGGGTCTTGTGCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923057573 Original CRISPR CCCAGCTCCAGGCACTCCTG AGG (reversed) Intergenic