ID: 923057578

View in Genome Browser
Species Human (GRCh38)
Location 1:230438717-230438739
Sequence GTCTTGTGCTCTGCGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923057573_923057578 -1 Left 923057573 1:230438695-230438717 CCTCAGGAGTGCCTGGAGCTGGG No data
Right 923057578 1:230438717-230438739 GTCTTGTGCTCTGCGGTGGATGG No data
923057570_923057578 4 Left 923057570 1:230438690-230438712 CCTGCCCTCAGGAGTGCCTGGAG No data
Right 923057578 1:230438717-230438739 GTCTTGTGCTCTGCGGTGGATGG No data
923057571_923057578 0 Left 923057571 1:230438694-230438716 CCCTCAGGAGTGCCTGGAGCTGG No data
Right 923057578 1:230438717-230438739 GTCTTGTGCTCTGCGGTGGATGG No data
923057567_923057578 19 Left 923057567 1:230438675-230438697 CCGTAGACACAGAGACCTGCCCT No data
Right 923057578 1:230438717-230438739 GTCTTGTGCTCTGCGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923057578 Original CRISPR GTCTTGTGCTCTGCGGTGGA TGG Intergenic