ID: 923059184

View in Genome Browser
Species Human (GRCh38)
Location 1:230454948-230454970
Sequence CTTTCAAAGGAGATGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923059184_923059192 -2 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059192 1:230454969-230454991 AGGGGATGAGCTCTAAGGAAGGG No data
923059184_923059193 2 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059193 1:230454973-230454995 GATGAGCTCTAAGGAAGGGTAGG No data
923059184_923059199 24 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059199 1:230454995-230455017 GATTCTGTGGGAGGGGTGCTTGG No data
923059184_923059195 12 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059195 1:230454983-230455005 AAGGAAGGGTAGGATTCTGTGGG No data
923059184_923059196 15 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059196 1:230454986-230455008 GAAGGGTAGGATTCTGTGGGAGG No data
923059184_923059201 30 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059201 1:230455001-230455023 GTGGGAGGGGTGCTTGGGAGTGG No data
923059184_923059198 17 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059198 1:230454988-230455010 AGGGTAGGATTCTGTGGGAGGGG No data
923059184_923059191 -3 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059191 1:230454968-230454990 AAGGGGATGAGCTCTAAGGAAGG No data
923059184_923059190 -7 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059190 1:230454964-230454986 TTGAAAGGGGATGAGCTCTAAGG No data
923059184_923059194 11 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059194 1:230454982-230455004 TAAGGAAGGGTAGGATTCTGTGG No data
923059184_923059200 25 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059200 1:230454996-230455018 ATTCTGTGGGAGGGGTGCTTGGG No data
923059184_923059197 16 Left 923059184 1:230454948-230454970 CCTTTTTCCATCTCCTTTGAAAG No data
Right 923059197 1:230454987-230455009 AAGGGTAGGATTCTGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923059184 Original CRISPR CTTTCAAAGGAGATGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr