ID: 923067041

View in Genome Browser
Species Human (GRCh38)
Location 1:230527492-230527514
Sequence CAGGATCTCATGGCTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923067036_923067041 -8 Left 923067036 1:230527477-230527499 CCATTCCTCCCAGTACAGGATCT No data
Right 923067041 1:230527492-230527514 CAGGATCTCATGGCTTCCCTTGG No data
923067034_923067041 2 Left 923067034 1:230527467-230527489 CCGGAGTGCACCATTCCTCCCAG No data
Right 923067041 1:230527492-230527514 CAGGATCTCATGGCTTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923067041 Original CRISPR CAGGATCTCATGGCTTCCCT TGG Intergenic
No off target data available for this crispr