ID: 923071046

View in Genome Browser
Species Human (GRCh38)
Location 1:230564733-230564755
Sequence CCATATGGCATATGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923071038_923071046 23 Left 923071038 1:230564687-230564709 CCCTTTTAAACACTATAATTGAA No data
Right 923071046 1:230564733-230564755 CCATATGGCATATGGGAAATGGG No data
923071039_923071046 22 Left 923071039 1:230564688-230564710 CCTTTTAAACACTATAATTGAAG No data
Right 923071046 1:230564733-230564755 CCATATGGCATATGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923071046 Original CRISPR CCATATGGCATATGGGAAAT GGG Intergenic
No off target data available for this crispr