ID: 923072122

View in Genome Browser
Species Human (GRCh38)
Location 1:230575419-230575441
Sequence ACATGGATGCTGCTGGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923072122_923072126 -5 Left 923072122 1:230575419-230575441 CCAGTGACCAGCAGCATCCATGT No data
Right 923072126 1:230575437-230575459 CATGTCACCTGGAAGCTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923072122 Original CRISPR ACATGGATGCTGCTGGTCAC TGG (reversed) Intergenic
No off target data available for this crispr