ID: 923072437

View in Genome Browser
Species Human (GRCh38)
Location 1:230577889-230577911
Sequence AAGGAGAAGAAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923072437_923072444 29 Left 923072437 1:230577889-230577911 CCCTTCTCCTTCTTCTTCTCCTT No data
Right 923072444 1:230577941-230577963 TTCTGTTGCCCAGAGTGCATTGG No data
923072437_923072441 1 Left 923072437 1:230577889-230577911 CCCTTCTCCTTCTTCTTCTCCTT No data
Right 923072441 1:230577913-230577935 TTCTTCCTCTTCTCCAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923072437 Original CRISPR AAGGAGAAGAAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr