ID: 923078273

View in Genome Browser
Species Human (GRCh38)
Location 1:230629517-230629539
Sequence CCATGTGGCCCTTTGTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923078266_923078273 -6 Left 923078266 1:230629500-230629522 CCAACCCTGGTGCTTCCCCATGT 0: 8
1: 25
2: 38
3: 68
4: 281
Right 923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG No data
923078268_923078273 -10 Left 923078268 1:230629504-230629526 CCCTGGTGCTTCCCCATGTGGCC No data
Right 923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG No data
923078265_923078273 -1 Left 923078265 1:230629495-230629517 CCTGACCAACCCTGGTGCTTCCC 0: 10
1: 28
2: 73
3: 123
4: 335
Right 923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG No data
923078259_923078273 27 Left 923078259 1:230629467-230629489 CCACCACAAAAGCTCTCTCCCTG No data
Right 923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG No data
923078261_923078273 24 Left 923078261 1:230629470-230629492 CCACAAAAGCTCTCTCCCTGGAT No data
Right 923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG No data
923078262_923078273 9 Left 923078262 1:230629485-230629507 CCCTGGATCTCCTGACCAACCCT No data
Right 923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG No data
923078263_923078273 8 Left 923078263 1:230629486-230629508 CCTGGATCTCCTGACCAACCCTG No data
Right 923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923078273 Original CRISPR CCATGTGGCCCTTTGTGATA TGG Intergenic
No off target data available for this crispr