ID: 923078653

View in Genome Browser
Species Human (GRCh38)
Location 1:230633015-230633037
Sequence AGAGATAGGGAAGGTGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923078647_923078653 12 Left 923078647 1:230632980-230633002 CCTTGAGGCTGGGAGAGCTTGTC No data
Right 923078653 1:230633015-230633037 AGAGATAGGGAAGGTGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923078653 Original CRISPR AGAGATAGGGAAGGTGTGTT AGG Intergenic
No off target data available for this crispr