ID: 923082310

View in Genome Browser
Species Human (GRCh38)
Location 1:230669913-230669935
Sequence CAGTGTACGAGGAAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923082310 Original CRISPR CAGTGTACGAGGAAGGTGCA GGG Intronic
900938071 1:5779684-5779706 GAGGGTACCAGGAAAGTGCAGGG + Intergenic
902192118 1:14771066-14771088 CAGTGTGGGAGGAGGGTGCGGGG + Intronic
904917302 1:33979439-33979461 CACAGTAGGAGGAAGGGGCAGGG - Intronic
905018829 1:34794784-34794806 CAGTCCACGAGGTAGGGGCAGGG - Exonic
907306093 1:53513889-53513911 CAGGGAAGGAGGAAGGTGCTGGG + Intronic
912627374 1:111216652-111216674 CAGTGTAAGAGGAAGGATAATGG - Intronic
917170239 1:172164798-172164820 CAGTGTATGAGGAAGGTAGTGGG + Intronic
920174031 1:204089162-204089184 CAGTGTTGGGGGAAGATGCATGG + Intronic
923082310 1:230669913-230669935 CAGTGTACGAGGAAGGTGCAGGG + Intronic
923737214 1:236621894-236621916 CTGTGTGCCAGGAAGGAGCATGG + Intergenic
924173206 1:241362671-241362693 CAGAGTACAGGGAAGGTACATGG - Intergenic
1066651856 10:37664019-37664041 GTGTGTAGAAGGAAGGTGCAAGG - Intergenic
1070452073 10:76569459-76569481 ACATGTATGAGGAAGGTGCAGGG + Intergenic
1071586818 10:86831200-86831222 TCGTGTATAAGGAAGGTGCAGGG - Intronic
1072535369 10:96358910-96358932 CAGTGTACGAAGAAGGTTCCTGG - Exonic
1073271230 10:102265935-102265957 CAGTGTAAGACTAAGGTGGAGGG + Intronic
1075671234 10:124265334-124265356 GAGTGTTTGAGGCAGGTGCAGGG - Intergenic
1079050866 11:17158010-17158032 AAGTTTAAGAGGAAGGTGAAGGG - Intronic
1080699068 11:34628953-34628975 CAGTGTAAAAGGAACATGCAGGG - Intronic
1083661929 11:64255465-64255487 CAGGGCAGGAGGAAGGTGCTGGG - Intronic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1083785141 11:64940672-64940694 CAGTGTAGGAGGAAAGTTTAAGG - Intronic
1084381936 11:68818119-68818141 CTGTCTTCCAGGAAGGTGCATGG + Intronic
1085393225 11:76193247-76193269 CAGTGTCCCTGCAAGGTGCAGGG - Intronic
1087433217 11:98080021-98080043 CAGAGCAGGAGGAAGGAGCAGGG - Intergenic
1090732408 11:129583142-129583164 CAGTGTACAAGGCAGGTACAAGG + Intergenic
1095257711 12:40059589-40059611 CAATGTATGGGGAAGGAGCACGG + Intronic
1096091316 12:48903672-48903694 CAGGGTTCGTGGAAGGTTCAAGG - Exonic
1096841655 12:54383549-54383571 CAGTGTTTGAGGAAGGTGAGTGG - Intronic
1097172977 12:57127973-57127995 CAGTCCGCGGGGAAGGTGCAGGG - Intronic
1100607208 12:96161665-96161687 AAGGGCACGGGGAAGGTGCAAGG + Intergenic
1103703397 12:122859322-122859344 CAGGGATCGAGGAGGGTGCATGG - Intronic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1104108721 12:125686926-125686948 GAGGGCACGAGGAAGCTGCATGG + Intergenic
1106610671 13:31276490-31276512 CAGTGTAGCAGGCAGGTCCAGGG + Intronic
1107127123 13:36857714-36857736 CAAAGTAGAAGGAAGGTGCAGGG + Intronic
1110374993 13:74783339-74783361 CATTGTACAAGGAAATTGCATGG - Intergenic
1110804670 13:79740033-79740055 AAATCTATGAGGAAGGTGCAAGG - Intergenic
1112462240 13:99613386-99613408 CAGTGTGTGAGGAAGCAGCAGGG + Intronic
1112757609 13:102655788-102655810 CAGTGTACGACGAAGAAGGAAGG - Intronic
1113357800 13:109600075-109600097 TAGTGTGCGGGGATGGTGCAGGG - Intergenic
1113709023 13:112452170-112452192 CCGTGGACGAGGAAGGGCCAGGG - Intergenic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1117496668 14:56312492-56312514 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1118125360 14:62896470-62896492 CATGGTAAGAGGAAGGTGAAAGG - Intronic
1121472154 14:94164402-94164424 CGGTGTATGTGGAAGGTGCAGGG + Intronic
1123760003 15:23424662-23424684 CAGTCCAGGAGGAAGGTGCAGGG + Intergenic
1124805729 15:32880519-32880541 CAGTGGAGAAGGAAGGTGAATGG - Intronic
1128254210 15:66185213-66185235 CAGGGTGGGAGGAGGGTGCAGGG - Intronic
1128877703 15:71215458-71215480 CAGCGTGCGAGGCAGGGGCAGGG - Intronic
1128893336 15:71350693-71350715 AAGTTTAGGAGGATGGTGCAGGG + Intronic
1129378642 15:75151681-75151703 CAGTGTAAAACGAAAGTGCAAGG - Intergenic
1130200966 15:81826472-81826494 CAGTGTATGAGCCAGGTGCCAGG - Intergenic
1133059787 16:3167016-3167038 CAGAGTCCAAGGAAGGTGCCAGG - Intergenic
1134456337 16:14398218-14398240 CAGTCCAGGAGGAAGGTGCAGGG - Intergenic
1137359814 16:47803887-47803909 CAGTGCACAAGGTAGCTGCAAGG + Intergenic
1137668433 16:50265633-50265655 CTGTGATGGAGGAAGGTGCAGGG + Intronic
1138910604 16:61393694-61393716 CAGTGTACAAGGATTATGCATGG + Intergenic
1140899974 16:79358380-79358402 CAGTGAACGAGGGAGGTCAAGGG - Intergenic
1143595591 17:7911846-7911868 CAGTGTGGGAGGAAGGTACTTGG - Exonic
1144508202 17:15851598-15851620 CAGAGGACGTGGAAGGTACAGGG - Intergenic
1145751138 17:27355894-27355916 CAGTGTCCAAAGCAGGTGCAAGG - Intergenic
1147502197 17:40976317-40976339 CAGTGTCAGTGGAAGCTGCATGG - Intergenic
1149545087 17:57497427-57497449 AAGTGAACCAGGAAGGTGCTGGG + Intronic
1157411297 18:47465540-47465562 CAGTGTTGGAGGAAGGAGCTGGG - Intergenic
1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG + Intronic
1162646412 19:12053245-12053267 CCGTGTAGGATGAAGGGGCAGGG - Intergenic
1162915107 19:13870500-13870522 CATAGCACCAGGAAGGTGCAGGG - Intronic
1163389345 19:17020944-17020966 CAGAGTCCCAGGAAGGTGGATGG - Intronic
1165327471 19:35122746-35122768 CAGTCTAGGAGGAAAGTGGAGGG - Exonic
926125291 2:10268093-10268115 ACGTGTACTAGGAGGGTGCACGG + Intergenic
927470864 2:23375487-23375509 AAGTGTATGGAGAAGGTGCAGGG + Intergenic
928679017 2:33680271-33680293 CAGTGTAAGATGAAAATGCAGGG + Intergenic
930024696 2:47023012-47023034 CAGTTTACCAGAAAGGTGCCTGG + Intronic
933728234 2:85438252-85438274 CAGGGCACCAGGAAGGGGCACGG + Intergenic
936343075 2:111654840-111654862 CAGTGTGGGAGGAAGGTGTCAGG - Intergenic
938128859 2:128693815-128693837 CAGAGTCGGAGGAAGGTGCCAGG + Intergenic
938945325 2:136207179-136207201 CATTGCAGGAGGAAGGAGCAAGG + Intergenic
942125678 2:172822791-172822813 CAGTGTAAGAGAACAGTGCAGGG - Intronic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
1173837906 20:46137876-46137898 CAGAGTAGGAGAAAGGAGCATGG - Intergenic
1177829792 21:26125238-26125260 CAGTGTATGAGGAGGATGCGGGG + Intronic
1180237955 21:46476440-46476462 GAGTGCCCGAGGAAGGCGCAGGG + Intronic
1181049728 22:20232794-20232816 CAGTGGACCAGGAAACTGCAGGG - Intergenic
1183705852 22:39474551-39474573 CAGTGTGCAGGGAAGGTGCTTGG - Intronic
1184581089 22:45418272-45418294 CAGTCTGCGGGGAAGGTGAATGG + Intronic
950756025 3:15173392-15173414 CAGTGTAAGAGGAAGGTCTGGGG - Intergenic
952553005 3:34500362-34500384 CAGTGGAGGAGGTATGTGCAGGG + Intergenic
959061177 3:101617908-101617930 CAGTGAAGGGAGAAGGTGCATGG - Intergenic
960564954 3:119123173-119123195 CAGTGTTCACGTAAGGTGCATGG - Intronic
963449042 3:145454145-145454167 CAGTGTACAAGAAGAGTGCAGGG + Intergenic
964406219 3:156351993-156352015 CAGTGTCCCAGGACAGTGCAGGG - Intronic
964544225 3:157815863-157815885 CAGTGTAGGTGGCTGGTGCATGG - Intergenic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
975007914 4:69313486-69313508 CAGAGTAGGAGGAAGGTGGAGGG - Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975867265 4:78736851-78736873 CAGTGCACTAGGATGGTGCCTGG + Intergenic
975973671 4:80072384-80072406 GAGTGTGCGAGGGAGGTCCAGGG - Intronic
979906561 4:126300738-126300760 CAGAGTAGGAGGGAGGTGCTGGG + Intergenic
985972645 5:3390641-3390663 CAGAGTCTGACGAAGGTGCAGGG + Intergenic
985972651 5:3390686-3390708 CAGAGTCTGACGAAGGTGCAGGG + Intergenic
985972657 5:3390731-3390753 CAGAGTCTGACGAAGGTGCAGGG + Intergenic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
993227998 5:85194366-85194388 CAGAGTACTAGGATGGGGCAGGG - Intergenic
996792872 5:127312093-127312115 CAGTGAGAGAGGAAGGAGCAAGG - Intronic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002426346 5:179178433-179178455 CAGTGGAGGAGGGATGTGCAGGG - Intronic
1007686402 6:43669739-43669761 CAGTGTGGGAGGAAGGAGCCTGG - Intronic
1009510246 6:64541650-64541672 CAGTGGATTAGGAAGGTGAATGG - Intronic
1009798180 6:68498835-68498857 CAATGGAGGAGGAAGGTGAAGGG - Intergenic
1012080040 6:94745772-94745794 CAGTATACTAGGAAATTGCAAGG + Intergenic
1012936412 6:105372481-105372503 CATTGTACCAGTAAGGTACAAGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1021658395 7:22894617-22894639 CAGTGCAGGAGGAAGGTGGTTGG + Intergenic
1021758770 7:23882629-23882651 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1024024826 7:45401196-45401218 CAGTGCAGGAGGATGGTGGAGGG + Intergenic
1027375352 7:77542745-77542767 CATTGTAGGAGGAAGTTTCAGGG + Intronic
1028505504 7:91566075-91566097 CGGTGTATGAGGAAAGTGGAAGG - Intergenic
1028619672 7:92811348-92811370 CAGTGTACAAGGATGGTGAAGGG - Intronic
1034924384 7:155109649-155109671 CTGTGTGTGAGGAATGTGCAGGG + Intergenic
1038752143 8:30305518-30305540 GAGTGTGAGAGGAAGGTGAATGG - Intergenic
1041231799 8:55759908-55759930 CAGTGTGGAAGGAAGGGGCAGGG - Intronic
1043880722 8:85539447-85539469 CAGTGATGGAGGAATGTGCAGGG - Intergenic
1049113406 8:140664595-140664617 CAGTGGATGAGGAAGGCACATGG - Intronic
1051421569 9:16894245-16894267 GAGTGAAAGAGGAAGCTGCAAGG - Intergenic
1051943933 9:22542896-22542918 CATTGCATGGGGAAGGTGCAAGG - Intergenic
1057304887 9:93906319-93906341 GAGTGAAGGAGGAAGCTGCAGGG + Intergenic
1057945760 9:99326598-99326620 TAGTGTACTAGAAAAGTGCAGGG + Intergenic
1060454101 9:123774009-123774031 CAGTGAAAGAGGAAGGGGAAGGG + Intronic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1185999480 X:4992525-4992547 CAGAGTACTAGGAAGATGTAAGG - Intergenic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1189304822 X:39979113-39979135 CAGTGTACAAGGAAGGTCACTGG + Intergenic
1190066110 X:47242809-47242831 CAGTGAACGAGGCAGAGGCAGGG - Intronic
1192926913 X:75764245-75764267 CAGCTTACTAGGAAGGTGAAAGG + Intergenic
1192941664 X:75919698-75919720 CAGAGTATGAGAAAGTTGCATGG + Intergenic
1193821039 X:86165142-86165164 CAGTGAACCAGGGAGGTGAAAGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic