ID: 923082806

View in Genome Browser
Species Human (GRCh38)
Location 1:230675132-230675154
Sequence CAAGAATCAAGACGACGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923082806_923082810 -9 Left 923082806 1:230675132-230675154 CCCGCCCGTCGTCTTGATTCTTG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 923082810 1:230675146-230675168 TGATTCTTGAAGATGTTAACCGG 0: 1
1: 0
2: 2
3: 23
4: 258
923082806_923082811 -2 Left 923082806 1:230675132-230675154 CCCGCCCGTCGTCTTGATTCTTG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 923082811 1:230675153-230675175 TGAAGATGTTAACCGGAGACTGG 0: 1
1: 0
2: 1
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923082806 Original CRISPR CAAGAATCAAGACGACGGGC GGG (reversed) Intronic
900767260 1:4513699-4513721 CAAGAATCCAGAAGACAGCCAGG + Intergenic
900876939 1:5349548-5349570 CAAGAAGCAGGATGAGGGGCTGG + Intergenic
901395778 1:8980368-8980390 CAAGAATATAGAAGATGGGCTGG + Intergenic
902899635 1:19505753-19505775 CAAGAATCAAGGTCAAGGGCAGG - Intergenic
907615098 1:55915884-55915906 CAAGTATCAAGTCAAGGGGCAGG + Intergenic
909090785 1:71222864-71222886 CAAGGAACAAGACCACAGGCAGG - Intergenic
917040753 1:170803496-170803518 CAAGCATAAAGACGAGGAGCAGG + Intergenic
918819813 1:189237541-189237563 CAAGAATCAAGATGGCGGATAGG - Intergenic
921085355 1:211785901-211785923 CAGGCATCAAGAAGAGGGGCTGG - Intronic
922183845 1:223257205-223257227 CAAGAATGTAGATGACGGGCTGG + Intronic
923082806 1:230675132-230675154 CAAGAATCAAGACGACGGGCGGG - Intronic
1066112777 10:32211837-32211859 CAAGAAGCAACATGATGGGCTGG - Intergenic
1073824395 10:107303955-107303977 GAAAAATCAAGAAGAAGGGCAGG - Intergenic
1075282088 10:121147813-121147835 CTAGGATCAAGACCAGGGGCAGG + Intergenic
1077823769 11:5781435-5781457 CAAGAATAAAGAAGTCGGGTAGG - Intronic
1080724388 11:34881095-34881117 CAAGAATCCAGAAAACAGGCTGG + Intronic
1103667314 12:122579358-122579380 TAAGAATACAGACTACGGGCCGG - Intronic
1108032166 13:46243670-46243692 TAAAAACCAAGAGGACGGGCTGG + Intronic
1113800148 13:113082311-113082333 CGAGAATAAAGATGAAGGGCTGG + Intronic
1119323270 14:73743957-73743979 CAACAATCAAGACCAAGGCCTGG + Intronic
1124885355 15:33680426-33680448 CAAGAAGCAAGATGACTGCCTGG - Intronic
1127482275 15:59388501-59388523 CAAGAATCAAGTTGAAAGGCTGG - Intronic
1128578783 15:68794212-68794234 CAAGAATGGAAACGAAGGGCAGG + Intronic
1133466052 16:6028084-6028106 CCAGAATCAAGACAGGGGGCTGG - Intronic
1136024997 16:27463405-27463427 CAAGAACCAAGGTGCCGGGCAGG + Intronic
1140886958 16:79252783-79252805 CAAAAATCAAAACCACGGCCGGG - Intergenic
1146065873 17:29634844-29634866 CAAGAATCAAGGGGAAGGCCAGG - Intronic
1149014193 17:51889224-51889246 CAAGAATCAAGCAGGTGGGCAGG + Intronic
1167749571 19:51371646-51371668 GAAGAAACAAGAGGAGGGGCTGG + Exonic
929491173 2:42397925-42397947 TTAAAATCAAGAAGACGGGCTGG + Intronic
936451412 2:112636445-112636467 CAAGAATAAAGACCAAGGCCTGG - Intergenic
937821220 2:126313283-126313305 CAAGGAGAAAGATGACGGGCTGG - Intergenic
941873148 2:170406671-170406693 TAAGAGTCAAGAAGACGGGTGGG - Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
953100826 3:39825013-39825035 CAAGAATCAATAGCACTGGCTGG - Intronic
961174295 3:124821242-124821264 CAAGTACTAAGACCACGGGCAGG + Intronic
962321842 3:134396835-134396857 CAAGCACCAAGAAGAAGGGCTGG + Intergenic
963108015 3:141663136-141663158 GAAGAATCAAAACGATGGGCAGG - Intergenic
970266714 4:14296401-14296423 GAAGAAACAAGACGAAGCGCTGG + Intergenic
970605985 4:17682297-17682319 CGAGAATCAAGGAGACTGGCAGG + Intronic
974379782 4:61124228-61124250 CAAGAATTTAGACAACAGGCTGG - Intergenic
978714273 4:111823040-111823062 CAAGAATCAACAGGAAGGGCCGG - Intergenic
984569752 4:181377440-181377462 CAAGAATAAAAAAGAAGGGCCGG - Intergenic
991362356 5:65833767-65833789 CAATAATCAAAAGGACAGGCAGG + Intronic
993685964 5:90937999-90938021 CAAAAATCAAGACACTGGGCAGG - Intronic
997331770 5:133068498-133068520 CAAGAATCAGGAGAACAGGCTGG + Intronic
1000380375 5:160623560-160623582 GAAGAAAAAAGAGGACGGGCTGG + Intronic
1006714256 6:36104681-36104703 CAAGAAAGAACACGACGGGCTGG - Intronic
1007638465 6:43315972-43315994 CAATAATAAAGATGATGGGCTGG - Intronic
1009368623 6:62875478-62875500 TTAGAATCAATATGACGGGCAGG - Intergenic
1017154692 6:151312494-151312516 TAAGAATCATGAGGACGGCCGGG + Intronic
1018948006 6:168359044-168359066 CAAGGAGCAAGAGGACTGGCAGG - Intergenic
1022313153 7:29216550-29216572 CAAGAAGCAGGAAGAAGGGCAGG - Intronic
1031002460 7:116432662-116432684 CAAGATTCAAGATGAGTGGCAGG + Intronic
1038490396 8:27966435-27966457 CAAGAATCAGGAAGACCAGCAGG + Exonic
1043916595 8:85929648-85929670 CAAGAATCAAAACTAGGGGTTGG + Intergenic
1045450168 8:102316728-102316750 CAATAATCAAGATGTAGGGCAGG + Intronic
1045692334 8:104772956-104772978 AAGGAATCAAGATGAGGGGCTGG - Intronic
1048698015 8:137050232-137050254 CAAGAATGAAGAGGAAGGGCAGG - Intergenic
1049663916 8:143834715-143834737 CAAGAATCAAGAGGCCAGGAAGG + Exonic
1052476620 9:28969343-28969365 CAAGTATAAAGACCAGGGGCAGG + Intergenic
1059249568 9:112876638-112876660 CAAGAATTAAGAATACAGGCAGG + Intronic
1061254910 9:129449357-129449379 CATGGATCATGAGGACGGGCGGG + Intergenic
1197742322 X:129904846-129904868 CAAGAATGAAAAGAACGGGCCGG + Intergenic