ID: 923083056

View in Genome Browser
Species Human (GRCh38)
Location 1:230678408-230678430
Sequence GAGTTAGCTGCCACTCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923083056 Original CRISPR GAGTTAGCTGCCACTCTTAA TGG Intronic
900724259 1:4204944-4204966 AAGTTAGCTGAAATTCTTAAAGG + Intergenic
920567981 1:206991143-206991165 GAGTTAGCTGCCACTAGCCAAGG - Intergenic
921786081 1:219231044-219231066 GAGTTAGCTGTCATTGTTAATGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1065809081 10:29424698-29424720 GAGTTAGCTGCCAATCTGAGGGG + Intergenic
1067555753 10:47268869-47268891 GATGTAGCTGCCAGGCTTAAGGG - Intergenic
1076372053 10:129961793-129961815 GAGTTAGCTGCCTTTGTTATAGG + Intronic
1077937702 11:6806482-6806504 GATTTAGCTCCCAATTTTAAGGG + Intergenic
1091322534 11:134662259-134662281 GAGTTACCGGCCACAATTAAAGG + Intergenic
1092125769 12:6074050-6074072 GAGTTTGGTGTCACTCTGAAAGG - Intronic
1092804482 12:12207133-12207155 AAGGTAGCTACCACTCTTTATGG - Intronic
1099203141 12:79698808-79698830 AAGTTATCTGCTCCTCTTAAAGG + Intergenic
1102137256 12:110585718-110585740 AGGTCAGTTGCCACTCTTAAAGG + Intergenic
1106403423 13:29451979-29452001 GAATTACCTGCCCCTCTTATAGG + Intronic
1108761719 13:53575047-53575069 GAGTTAGCTTGCACTATTCATGG + Intergenic
1112966105 13:105196130-105196152 GAGTTTGCTGCCCCTCTCCATGG - Intergenic
1116620489 14:47196882-47196904 TGGTTAGCTGCCACTTATAAGGG + Intronic
1116704244 14:48276339-48276361 CATTTAGCTCCCACTCATAAAGG + Intergenic
1119905191 14:78295573-78295595 GATTTATATGCCACTCTAAAGGG + Intronic
1119968858 14:78947171-78947193 GAGGTAGCTGCCACACAGAATGG - Intronic
1122112675 14:99513247-99513269 GACTTGGCTGCCACTCAAAATGG + Exonic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124376824 15:29133762-29133784 GAGTTAGCTGCCGCTGTCACTGG - Intronic
1125006083 15:34819694-34819716 GAGCTAGCTGCCACGATGAAAGG + Intergenic
1129148359 15:73670450-73670472 AAGATAGCTGACACTTTTAAGGG - Intergenic
1130078421 15:80710072-80710094 GGGTTGGCTGCAACTTTTAAAGG + Intronic
1131184707 15:90264815-90264837 GAGTCAGATGCCACTCTTTCCGG - Exonic
1135526938 16:23220397-23220419 GACTTATCTGCAACTCTGAATGG + Intergenic
1141379948 16:83567159-83567181 GGCTTAGCTGCCACTCTTCTGGG + Intronic
1141827698 16:86492801-86492823 GAGTTTCCTGCCACTCTGAGAGG - Intergenic
1144269805 17:13604707-13604729 AAGCTTGCTGCCACTCTCAAGGG - Intergenic
1146608889 17:34287433-34287455 GGGTTAGTTGCTGCTCTTAAAGG - Intronic
1147859176 17:43507126-43507148 GACATAGCTGCCACTCTTCTGGG - Exonic
1151180542 17:72324327-72324349 GAGTGTGCAGCCACTCTTCATGG - Intergenic
1157070885 18:44406702-44406724 AAGTTAGCTGCTAATCTTAATGG - Intergenic
1158813973 18:61072182-61072204 GTGTTAACTGTCAGTCTTAAAGG - Intergenic
933064448 2:77776508-77776530 TATTTAGCTGCCACTTATAAGGG + Intergenic
940688537 2:156884866-156884888 GAATTAGATGCCACTCCTATGGG - Intergenic
944427233 2:199595888-199595910 CACTTCGCTGCCACTCCTAAAGG - Intergenic
947791908 2:232873422-232873444 GGGTGAGCTGCCACCCTTGACGG - Intronic
1169893574 20:10478839-10478861 GAGGTAGCTGCCACTCCCAAGGG + Intronic
1173443616 20:43098453-43098475 TAGTTACCTGGCACTCTTAGGGG - Intronic
1177127274 21:17210795-17210817 AAGTTACCTGCCAGTCTGAAAGG - Intergenic
1177741841 21:25164070-25164092 CAGTTAGCTCCCACTTATAAGGG + Intergenic
1179361740 21:40715752-40715774 GAGGTAACTGTCACTCTTCAAGG + Intronic
949255656 3:2042813-2042835 GATTTAGCTCCCACTTGTAAAGG + Intergenic
957782672 3:84839747-84839769 TAGTTAGCTAACACTTTTAATGG - Intergenic
965104372 3:164339298-164339320 GAGTTAGGTGGCCCTCTTAAGGG - Intergenic
965897141 3:173592467-173592489 GAATTAGCTGCCAGTCTACATGG + Intronic
979840114 4:125428354-125428376 GACTAAGCTACCAGTCTTAAAGG + Intronic
984449043 4:179875636-179875658 CAGTTAGCTCCCACTGATAAAGG - Intergenic
990054579 5:51556237-51556259 GAGGTTTCTGCCACTATTAATGG + Intergenic
990388170 5:55288970-55288992 GAGTTTCCTGCCACCTTTAATGG - Intronic
993263002 5:85684784-85684806 AGATTAGCTGCCACTCTAAATGG - Intergenic
993562979 5:89434873-89434895 GAGTTCCCTGGCATTCTTAAAGG + Intergenic
994080055 5:95698513-95698535 GGGTTATTTGCCACTCCTAAGGG + Intronic
994507602 5:100662348-100662370 CTGTTAGCTGCCACTCTGAAGGG + Intergenic
995066247 5:107866496-107866518 GATATGGCTGCCGCTCTTAACGG + Intronic
997351417 5:133233943-133233965 GGGTTAGCTGACTTTCTTAAGGG + Intronic
998401287 5:141850333-141850355 GATTTAGCTCCCACTCTCCACGG + Intergenic
998735542 5:145135515-145135537 AAGTTAGCTGCCACATTTTAAGG + Intergenic
1000715100 5:164632645-164632667 TAATTAGCTGGCATTCTTAAAGG + Intergenic
1000759004 5:165197853-165197875 CATTTAGCTCCCACTCATAAGGG - Intergenic
1006566137 6:34959253-34959275 GAGATTGTTGCCATTCTTAATGG + Intronic
1007917320 6:45573466-45573488 GACTTAGCTGCCATTCTCATCGG + Intronic
1008691804 6:53987544-53987566 TACTTAGTTGCCTCTCTTAAAGG - Intronic
1013881075 6:114901536-114901558 CATTTAGCTCCCACTTTTAAGGG + Intergenic
1016293220 6:142546265-142546287 GGTTTAGGTTCCACTCTTAATGG + Intergenic
1028192172 7:87866344-87866366 GAGTTAGATGACATTTTTAAAGG - Intronic
1028901173 7:96101886-96101908 GAGATTGGTGCCACTCTTAAAGG + Intronic
1030823724 7:114128244-114128266 GAATTTTCTGCAACTCTTAATGG + Intronic
1032537779 7:132678755-132678777 AGGTTAGATGCCCCTCTTAAAGG - Intronic
1036615326 8:10383144-10383166 GAGTTGGCTGGCACCCTTCATGG - Intronic
1039111086 8:34041189-34041211 GAGTTAGATGCCCCTCCTATGGG - Intergenic
1046009410 8:108528211-108528233 GAGGTAGCTGTCTCTCTGAATGG - Intergenic
1052540243 9:29802331-29802353 GAGATAGCTGAAACTCTCAAAGG + Intergenic
1054762527 9:69015776-69015798 GAATTAGCTGTCAAACTTAAAGG - Intergenic
1055646208 9:78363787-78363809 GATTTAGGTGCTACTCTGAAAGG - Intergenic
1186526742 X:10255710-10255732 GAGCAAGCTGCCACTGTTAGTGG - Intergenic
1187274766 X:17807553-17807575 GAGTAAGCTGCAACTCAAAAAGG + Intronic
1187345944 X:18463880-18463902 GAGCTAGCTGCCTATTTTAAAGG - Intronic
1187510224 X:19910903-19910925 GAGTTAGCTGCCCCTCCTCTGGG - Intergenic
1188235497 X:27725981-27726003 GAGTTAGCAACCTATCTTAATGG + Intronic
1194047797 X:89030980-89031002 AAGTTAGGTGGAACTCTTAAAGG + Intergenic