ID: 923084302

View in Genome Browser
Species Human (GRCh38)
Location 1:230690796-230690818
Sequence ATGTATAATACAGTTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 389}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923084300_923084302 9 Left 923084300 1:230690764-230690786 CCATTTATGGGTTAATTTAGAAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 923084302 1:230690796-230690818 ATGTATAATACAGTTTTTGTGGG 0: 1
1: 0
2: 2
3: 40
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923084302 Original CRISPR ATGTATAATACAGTTTTTGT GGG Intronic
901524066 1:9808209-9808231 ATGGAAAATACAGTATTTGTGGG - Intronic
901576518 1:10205497-10205519 GTGTTTAATACAGTGTATGTGGG - Intergenic
902239669 1:15080240-15080262 AAGTATAAAGCAGTTATTGTTGG + Intronic
904846803 1:33425800-33425822 ATGTATACTGCAGTTTATATTGG + Intronic
908399441 1:63756760-63756782 ATGTATAATAAAGTCTATTTTGG + Intergenic
909398756 1:75200682-75200704 CTTTATAAATCAGTTTTTGTTGG - Intergenic
909412274 1:75368404-75368426 ATCAAAAATACAGTATTTGTGGG - Intronic
909758896 1:79264889-79264911 ATGTATAAGATAATTTATGTGGG + Intergenic
910251002 1:85199930-85199952 AAGTATAACACACTTTTAGTAGG - Intronic
910678213 1:89836240-89836262 ATTTAAAATACAATTTTTGCTGG + Intronic
911377895 1:97074112-97074134 ATGTATTATCCAGCTCTTGTAGG - Intergenic
911398391 1:97340920-97340942 ATGTATAAAACAGCTATTTTGGG - Intronic
913649802 1:120902002-120902024 ATTGAAAATACAGTATTTGTGGG - Intergenic
916382348 1:164225941-164225963 ATGAAAAATATAGTTTCTGTAGG - Intergenic
917888393 1:179411571-179411593 ATGTATAATGTAACTTTTGTGGG + Intronic
918395411 1:184109370-184109392 TTGTATAAAATAGTTTTTATTGG + Intergenic
918601669 1:186371152-186371174 ATGTACAATGCAGTCTTTCTGGG - Intronic
918998173 1:191790195-191790217 ATTTAAAATACTGTTTTTATTGG - Intergenic
919574172 1:199286173-199286195 ATATATAATGCTGTGTTTGTGGG + Intergenic
919961161 1:202470474-202470496 ATTTAAAATACAGTTACTGTGGG - Intronic
921040725 1:211429183-211429205 ATTGACAATACAGTATTTGTGGG + Intergenic
921783533 1:219198362-219198384 ATATATAATCCAGTTTTCATGGG + Intronic
921832193 1:219740534-219740556 ATTTATCATACTGTTTTTATGGG - Intronic
922409510 1:225357880-225357902 TTGTATAAAACAGTTTTTATGGG + Intronic
923084302 1:230690796-230690818 ATGTATAATACAGTTTTTGTGGG + Intronic
923369109 1:233292503-233292525 ATGTTTAAGAAAGTTTTGGTTGG - Intronic
923817059 1:237392277-237392299 ATGTACAATAAATTTATTGTTGG - Intronic
923897602 1:238289928-238289950 ATTTATATTACAGTATTTATAGG - Intergenic
924412000 1:243815979-243816001 TTTTATTATACAGTTTCTGTGGG + Intronic
1063658794 10:8018832-8018854 ATGTACCACACAGTTTTTGTTGG + Intergenic
1064891656 10:20181879-20181901 ATGGAGAACAGAGTTTTTGTTGG + Intronic
1065742002 10:28805392-28805414 ATGTATTTTAAAATTTTTGTGGG + Intergenic
1066535981 10:36392558-36392580 ATTTATAATACAATTTTTTTAGG + Intergenic
1067397102 10:45931386-45931408 ATGTTTAATGAAGTTTGTGTAGG - Intergenic
1067865418 10:49900487-49900509 ATGTTTAATGAAGTTTGTGTAGG - Intronic
1068330142 10:55554574-55554596 ATCGAAAATACAGCTTTTGTGGG + Intronic
1069074664 10:64026152-64026174 AAATACAATACAGTTTTTTTGGG - Intergenic
1070095976 10:73338757-73338779 ATCAAAAATACAGTATTTGTGGG + Intronic
1070228777 10:74541563-74541585 ATGATTAATACATTTTTTATAGG + Intronic
1070475748 10:76827482-76827504 ATGTATGATCCAGTTTTTGAAGG - Intergenic
1071686943 10:87768496-87768518 ATGTTTAACAGAGTATTTGTTGG - Intronic
1073680540 10:105698851-105698873 ATGTGTAATACAGTTCTCCTGGG - Intergenic
1074332471 10:112529909-112529931 ATTTATGATGCAGTTTTTTTAGG + Intronic
1074453332 10:113577069-113577091 ATGTATAAAACAATGTTTGAGGG - Intronic
1075577730 10:123591219-123591241 ATAAAAAATACAGTATTTGTGGG + Intergenic
1075938171 10:126361783-126361805 ATCTTTAATCCAGTTTTAGTTGG - Intronic
1076458905 10:130624731-130624753 ATATTTAATAGAGTTCTTGTCGG - Intergenic
1077936761 11:6796275-6796297 ATCTATATTTCAGTTTTTTTAGG - Intergenic
1078307829 11:10208215-10208237 ATGTATTTCACATTTTTTGTTGG - Intronic
1078679782 11:13464720-13464742 ATGTATACTATAGTTTTATTTGG + Intergenic
1080032315 11:27674826-27674848 AAATACAATACAGTATTTGTTGG + Intronic
1080127912 11:28759156-28759178 ATGTTTTACTCAGTTTTTGTGGG + Intergenic
1080322539 11:31030056-31030078 ATGTGAAATATAGTTATTGTGGG + Intronic
1082639396 11:55638629-55638651 TTGTATCATACAGTTATTATAGG - Exonic
1083138455 11:60701743-60701765 ATACATATCACAGTTTTTGTGGG - Intronic
1084291185 11:68169334-68169356 ATATATAATGAAGTTTTTGGAGG - Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085983079 11:81748370-81748392 AGGCATAAAACAGATTTTGTAGG + Intergenic
1086021086 11:82230452-82230474 ATGTATATTTGAGATTTTGTTGG + Intergenic
1086099464 11:83083716-83083738 ACGTATAATAAAGTTCTTTTGGG + Intergenic
1086829542 11:91543079-91543101 ATTTATAATTCAGTCTTTGTAGG - Intergenic
1089924686 11:122245269-122245291 ATGGATAATACAGCTTATGGGGG - Intergenic
1090681062 11:129057669-129057691 ATTGAAAATACAGTATTTGTGGG - Intronic
1092644912 12:10559975-10559997 GTGTCAAATACAGTTTTTGGGGG + Intergenic
1094006180 12:25754369-25754391 AGGAATAATACAGTTTTTTTGGG - Intergenic
1094071649 12:26421842-26421864 ATCCCTGATACAGTTTTTGTTGG + Intronic
1094123030 12:26994093-26994115 TTGTATAATAGGCTTTTTGTAGG - Intronic
1094562152 12:31565502-31565524 ATGAAAATTACAGATTTTGTTGG - Intronic
1095238458 12:39828065-39828087 ATATATAATAGTATTTTTGTTGG - Intronic
1095570610 12:43680908-43680930 ATGTATAAAACAAATTATGTGGG + Intergenic
1098823372 12:75261580-75261602 TTGTACAGTACAGTTTTTGCTGG - Intergenic
1099647444 12:85376967-85376989 ATGTACACTAAAGTTTCTGTGGG + Intergenic
1100709274 12:97237319-97237341 CTGTATAATGGAGTTTTTGCTGG + Intergenic
1100842243 12:98624561-98624583 TTTTATAATGCAGTTTTTGATGG - Exonic
1101124590 12:101618697-101618719 ATAAATAAAAGAGTTTTTGTTGG - Intronic
1102357887 12:112255152-112255174 ATGCAAAATACAGTTTTTAAAGG + Intronic
1102631859 12:114288042-114288064 ATCTATCTTACAGTTTTTGTGGG + Intergenic
1103241325 12:119415867-119415889 TTGTATATTACAGTTTTATTGGG - Intronic
1103424573 12:120821541-120821563 AATTATAATACAGCTTTTGAAGG + Intronic
1105074799 13:16000584-16000606 ATTTTTTATACACTTTTTGTAGG + Intergenic
1105075389 13:16011839-16011861 ATTTTTTATACACTTTTTGTAGG + Intergenic
1105723824 13:23141813-23141835 AAACAAAATACAGTTTTTGTGGG - Intergenic
1105845299 13:24288926-24288948 TTGAATAGTACAGCTTTTGTAGG - Intronic
1106742701 13:32663590-32663612 ATGTATGATACAGTATTTAATGG + Intronic
1106982351 13:35302473-35302495 GAGTATAATTCAGTTTTTGAAGG - Intronic
1107397198 13:40030213-40030235 ATTGAAAATACAGTATTTGTGGG - Intergenic
1108650074 13:52469536-52469558 CTGTAAAATACAGATTTTTTGGG + Intronic
1108728451 13:53206579-53206601 ATCTTTAATACAGGTTTGGTGGG - Intergenic
1109138720 13:58685637-58685659 ATGTCTCATACACTTTTAGTGGG + Intergenic
1109488708 13:63064817-63064839 ATGTAAAATAGGGTTTTTTTTGG - Intergenic
1110103349 13:71637092-71637114 ATGTATAATACAGTGGCTGGGGG + Intronic
1110402014 13:75103102-75103124 ATCTATAATTCAATTTTTTTAGG - Intergenic
1110689695 13:78417860-78417882 TAGCATATTACAGTTTTTGTTGG + Intergenic
1110748823 13:79089206-79089228 ATGCATAAAACTGTTTTTGGTGG - Intergenic
1111010625 13:82309680-82309702 CTCTATAATTCAGTCTTTGTAGG + Intergenic
1111374424 13:87359411-87359433 ATGTATGAAATATTTTTTGTTGG - Intergenic
1111456437 13:88490304-88490326 ATATATAAAACTGTTGTTGTTGG + Intergenic
1111632652 13:90862337-90862359 ATGTATAAGACTATTCTTGTAGG + Intergenic
1112905812 13:104419845-104419867 ATTTCTAATACAGTTTTTCCTGG - Intergenic
1114304236 14:21406566-21406588 ATGAAAAATATAGTTGTTGTAGG + Intronic
1114857990 14:26475513-26475535 ATGTAGAAAAAAATTTTTGTAGG - Intronic
1116070877 14:40043738-40043760 TTGTATAGTACAGATTTTGGGGG - Intergenic
1116373359 14:44164981-44165003 ATTTGTAAGACTGTTTTTGTGGG - Intergenic
1116451962 14:45077232-45077254 ATGTATAAGAAAGCATTTGTAGG + Intergenic
1116654595 14:47636361-47636383 ATGAAGAAGGCAGTTTTTGTTGG + Intronic
1116686279 14:48043158-48043180 ATGTATACTTCAGGTTTTTTTGG - Intergenic
1117608164 14:57453500-57453522 ATGGAAAATACAGTGTTTGCAGG - Intergenic
1118147430 14:63155797-63155819 ATGTAGGATACAGTGTTTCTGGG - Intergenic
1118802220 14:69201160-69201182 ATGTATAATACATCTTACGTTGG + Intronic
1118931556 14:70246584-70246606 ATGAAGAATTCTGTTTTTGTGGG - Intergenic
1118953608 14:70458554-70458576 ATGAAGAATTCTGTTTTTGTGGG + Exonic
1120023291 14:79554061-79554083 ATGTAAAATACCAATTTTGTTGG + Intronic
1120699609 14:87684396-87684418 ATGTTTAATAAGGATTTTGTGGG - Intergenic
1121132952 14:91465501-91465523 ATGTGTTAAACAGTTTTTTTTGG - Intronic
1122449863 14:101797057-101797079 CTGTTTAATGGAGTTTTTGTTGG - Intronic
1123504224 15:20922799-20922821 ATGTTTAATAAGGTTTTTATTGG - Intergenic
1123597713 15:21933776-21933798 ATGTTTAATAAGGTTTTTATTGG - Intergenic
1125161595 15:36650800-36650822 ATGTAAAATACAGATTTTGATGG + Intronic
1125370922 15:38975424-38975446 ATGTGTAATAAGGTTTGTGTGGG - Intergenic
1126441551 15:48694881-48694903 ATGTGTAATACATATTTTGTGGG - Intergenic
1127228326 15:56959559-56959581 AGCAATAATTCAGTTTTTGTAGG + Intronic
1127508072 15:59614076-59614098 ATCTATAATGCAGTTTTTATGGG + Intronic
1128043198 15:64593693-64593715 ATGTTTTATATATTTTTTGTAGG + Intronic
1128127862 15:65206058-65206080 ATGGATAATACAGATGTTATGGG - Intronic
1129258704 15:74350294-74350316 ATTTAAAATACAACTTTTGTGGG - Intronic
1130447828 15:84020484-84020506 ATGTAAAATACATTTTTAGTTGG - Intronic
1130448041 15:84022526-84022548 ATGTAAAATATATTTTTAGTTGG - Intronic
1133558840 16:6931024-6931046 ATGTAGAAATCAGGTTTTGTTGG + Intronic
1133817764 16:9211253-9211275 AGGTATAATACAATTTTGGATGG - Intergenic
1135490416 16:22904656-22904678 ATGAAAAATACAGTTTTTGGAGG + Intronic
1137941410 16:52691210-52691232 ATCAAAAATACAGTATTTGTAGG + Intergenic
1137951717 16:52790182-52790204 ATGTATATTACAATTGTAGTAGG + Intergenic
1138026523 16:53526515-53526537 ATCAAAAATACAGTATTTGTGGG - Intergenic
1138653632 16:58476556-58476578 ATGCATCATACAGTCTCTGTTGG + Intronic
1138684875 16:58716283-58716305 ATTTATAATAAAGTTATTTTGGG - Intronic
1140932952 16:79644677-79644699 ATCTATAATACATGTTTTGTTGG - Intergenic
1143928524 17:10395547-10395569 AAGTATAATACAGTAGTTCTGGG + Intronic
1144111265 17:12035696-12035718 ATGTATCATACAGTAGTTGTAGG + Intronic
1146463835 17:33069731-33069753 ATTTAAAATACATTTTTTCTGGG + Intronic
1147273616 17:39295820-39295842 TTGTATAATACACCTTTTATAGG - Intronic
1148271338 17:46264262-46264284 TTGTATAATAAAGAATTTGTAGG - Intergenic
1148528416 17:48365336-48365358 ATATATAACATTGTTTTTGTGGG - Intronic
1148967160 17:51445933-51445955 ATGTGCAACAGAGTTTTTGTGGG - Intergenic
1150023547 17:61647006-61647028 TTGTATAATAGGGATTTTGTGGG - Intergenic
1150115494 17:62545378-62545400 AGGTATCATCCAGTTTTTCTGGG + Intronic
1150507736 17:65716648-65716670 ATTTATAATAATGTTTCTGTTGG + Intronic
1152007155 17:77689729-77689751 ATGTACAATTAAGTTATTGTTGG - Intergenic
1153508582 18:5829193-5829215 CTGTGTAAAACAGTTTTTGGTGG + Intergenic
1153723706 18:7934697-7934719 ACGTATAATAAAATTCTTGTAGG - Intronic
1155714853 18:28928674-28928696 ATGTAGAATACAGTTTTAGTAGG - Intergenic
1156790092 18:40961917-40961939 TTTTCTAATAAAGTTTTTGTCGG + Intergenic
1156989339 18:43388415-43388437 ATATATATTCCAGTTTTTGGTGG + Intergenic
1158169436 18:54579901-54579923 CTGTATAGTACTGTTTTTATAGG - Intergenic
1158382880 18:56954188-56954210 GTGTTTAATACTGTTTTTGCTGG + Intronic
1158685547 18:59610916-59610938 ATGCATAATAGAGGTGTTGTGGG - Intronic
1158816822 18:61109743-61109765 AGGTATAATTCATTTTATGTTGG + Intergenic
1159270705 18:66146251-66146273 ATTTACAATAAAGTTATTGTGGG - Intergenic
1159528918 18:69630072-69630094 CTGTATATTACAGTTTCTGCTGG - Intronic
1159546403 18:69844168-69844190 AGATATAATACAATTTTTGAAGG - Exonic
1159549690 18:69881463-69881485 ATGTTTTAAACAGTTTTTTTTGG + Intronic
1159580348 18:70228840-70228862 ATGTAAAATACAGATTTGTTGGG - Intergenic
1159651583 18:70985017-70985039 TTTTATCTTACAGTTTTTGTGGG - Intergenic
1160071649 18:75634389-75634411 ATATATAATATAATGTTTGTAGG - Intergenic
1167129622 19:47575674-47575696 ATGTAAAATACTGTATATGTGGG - Intergenic
1167813955 19:51862254-51862276 ATGTATAACAAAGTTTTTTTTGG + Intronic
924981466 2:226301-226323 ATCTATATTATAGGTTTTGTTGG - Intronic
925982484 2:9188416-9188438 ATGTATAATAAGGGCTTTGTAGG + Intergenic
926345379 2:11940195-11940217 AAGGATAATACATTTTTTGCCGG - Intergenic
926449060 2:12980289-12980311 ATTTATAACACACTTTATGTTGG - Intergenic
928552275 2:32384189-32384211 ATGTATGATACAGTTTCTCTGGG - Intronic
928562759 2:32508388-32508410 CTGTATAATACAATTTTATTAGG + Intronic
929153661 2:38770713-38770735 ATGTACAATACTTTTTTTGGTGG + Intronic
929181459 2:39044655-39044677 ATCAAAAATACAGTATTTGTGGG + Intronic
930736134 2:54780671-54780693 ATGTACTACACAGTTTTTGATGG + Intronic
931597726 2:63968190-63968212 ATGTATAATCCATTTTTTTCTGG - Intronic
932919550 2:75895013-75895035 ATGGATAAGAGAGTTTTTGAAGG + Intergenic
935419165 2:102848789-102848811 AAGTATAAGACAGTTTTTTGAGG + Intergenic
935872350 2:107464761-107464783 ATGTATGATACATATTTTCTGGG - Intergenic
937215135 2:120307908-120307930 TTGTATCTTACAGTTTCTGTGGG + Intergenic
937548868 2:123061296-123061318 ATATAAAATACAATCTTTGTAGG - Intergenic
937778070 2:125804787-125804809 ATGTTTAAAACACATTTTGTTGG - Intergenic
938016104 2:127868536-127868558 ATGTGAAACACAGTATTTGTTGG - Intronic
939802253 2:146724163-146724185 CTGTATAATCCATTTTATGTAGG - Intergenic
940060494 2:149560376-149560398 ATCTAGAATACAGCTTTTCTGGG - Intergenic
940486649 2:154304047-154304069 ATATATAAAAAAGTTTTTGCGGG - Intronic
940609602 2:155972256-155972278 ATCTATAAATCAGTTTTTCTAGG - Intergenic
941116447 2:161478086-161478108 ATCAAAAATACAGTATTTGTGGG + Intronic
941269377 2:163406469-163406491 ATGTTTAATAAAGTTTTTAAGGG + Intergenic
942902150 2:181133853-181133875 ATATGTAATATAGTTTTTTTGGG + Intergenic
943710322 2:191086605-191086627 AAGTATACTACAGTTTCTTTTGG - Intronic
943919307 2:193682243-193682265 ATGTCCAATAGAGTTTTTCTAGG + Intergenic
944209117 2:197188070-197188092 ATGTTTAAGACAGTACTTGTTGG - Intronic
944816334 2:203379754-203379776 ATATATACTTCAGTTTTTGTGGG + Intronic
944993734 2:205270218-205270240 ATTCATAATACAATTTGTGTTGG + Intronic
945304683 2:208247831-208247853 ATGTTTAATACAATCTTTGGTGG + Intronic
945477689 2:210304829-210304851 TTCTAAAATACAGTTTTGGTTGG - Intronic
1168802395 20:652027-652049 ATGTATAATATAATTTCTGGTGG + Intronic
1169574823 20:6947770-6947792 ATGTAGAATATAATTTTTATAGG + Intergenic
1170350203 20:15432046-15432068 AAGTATAAAAAAGTTCTTGTAGG - Intronic
1170379090 20:15736719-15736741 ATGGAAAATACAGTATTTGAGGG + Intronic
1172276242 20:33680998-33681020 ATTTATTATATAGTTTTTGTGGG - Intronic
1173136151 20:40440916-40440938 ATTAAAAATACATTTTTTGTAGG - Intergenic
1173233384 20:41220650-41220672 CTATATGATACAGTTTTTTTTGG + Intronic
1173692687 20:44976293-44976315 AGGTCTAATACAGTTTTGGTAGG + Intronic
1173998015 20:47354310-47354332 TTGCATAATACTGTGTTTGTTGG - Intronic
1175095950 20:56541587-56541609 ACTTATCACACAGTTTTTGTGGG - Intergenic
1175968575 20:62672487-62672509 ATGGAAAATGCAGTTTTTGTGGG + Intronic
1177295763 21:19173307-19173329 AATTAGAATACAATTTTTGTAGG - Intergenic
1177466372 21:21486558-21486580 ATGTAAAAAACAGTTTCTGGAGG - Intronic
1177483615 21:21726238-21726260 AAATATAATACAGTTTATATAGG + Intergenic
1177954490 21:27580298-27580320 AAGTAAAATAAAATTTTTGTAGG - Intergenic
1177982164 21:27927688-27927710 ATATTTAATTCTGTTTTTGTAGG + Intergenic
1178957573 21:37037194-37037216 AGGAATAATACATTTTTTGGGGG + Intergenic
1179771700 21:43624140-43624162 ATGTATGTTTCAGTTTTTCTGGG - Intronic
1182142608 22:27974341-27974363 TTGTAGAATACATATTTTGTTGG - Intergenic
950409096 3:12823266-12823288 ATTTTAAATACAGTTTTTGTTGG + Intronic
950945970 3:16946562-16946584 ATTTATATTACAGTTTTTATGGG + Intronic
951096438 3:18637273-18637295 CTGTACAGTTCAGTTTTTGTGGG - Intergenic
952068262 3:29599209-29599231 ATGTATAATAAAGTTATTATTGG - Intronic
952667077 3:35920293-35920315 ATGTATCATAGTCTTTTTGTAGG + Intergenic
953222378 3:40984588-40984610 ATGTGGAATACAGTCTGTGTGGG - Intergenic
953728983 3:45429034-45429056 ATTTATAATCCAGTTTATATGGG + Intronic
953808242 3:46090127-46090149 ATTTCTTATACAGTTTCTGTGGG + Intergenic
954565090 3:51593017-51593039 ATGAATAATCTAGTTTTAGTTGG + Intronic
954834766 3:53456312-53456334 ATGTGTAGACCAGTTTTTGTAGG + Intergenic
955897318 3:63714255-63714277 ATGCAAAATACAGTATTTGGGGG + Intergenic
956368031 3:68526629-68526651 CTCTATAATATAGTTTTTGCTGG - Intronic
956619549 3:71207500-71207522 ATGTATATTGGAGTTTTTGAAGG - Intronic
957248771 3:77746257-77746279 ATGTATAATACAGATAATTTGGG + Intergenic
957340030 3:78883728-78883750 AAATATAGTATAGTTTTTGTGGG + Intronic
957473328 3:80690806-80690828 ATGTATGATACAGTCATTTTTGG - Intergenic
957518717 3:81290927-81290949 ATCTAAAATACAATATTTGTAGG - Intergenic
957550644 3:81699332-81699354 AGATATCTTACAGTTTTTGTGGG - Intronic
957901946 3:86505866-86505888 ATTTATGATACTGTTTTTTTAGG + Intergenic
958501233 3:94911696-94911718 AAGTATAATATAATTTTTGCAGG - Intergenic
958665427 3:97130408-97130430 AGGTTTAATCCAGTTTTTATAGG + Intronic
958740680 3:98066889-98066911 ATGTATACTAAAGTTTATATAGG - Intergenic
959343039 3:105155831-105155853 TTGTATAGTACATTTGTTGTAGG - Intergenic
959424576 3:106170420-106170442 ATGCATAATAAAGTTCTTCTGGG + Intergenic
960250953 3:115452747-115452769 ATGGATAAAACATTTTTTGGGGG - Intergenic
960963896 3:123091343-123091365 ATGTATCATATGGTTTTTGGCGG + Intronic
961747088 3:129071113-129071135 ATGCTTAATACAGATTTTTTTGG - Intergenic
962551661 3:136499079-136499101 ATTGAAAATACAGTATTTGTGGG - Intronic
963350899 3:144149833-144149855 ATGTATAAATCAATATTTGTGGG + Intergenic
963666415 3:148193379-148193401 ATCTATGACATAGTTTTTGTTGG - Intergenic
963710155 3:148738034-148738056 ATTCATAATACAATTTCTGTGGG - Intronic
964926942 3:161970678-161970700 ATTGAAAATACAGTATTTGTGGG - Intergenic
965075313 3:163967969-163967991 TTGTATTTTACAATTTTTGTGGG - Intergenic
966175043 3:177129151-177129173 AAGTATAATACAATTTTTTGTGG - Intronic
966495130 3:180571579-180571601 ATGTTTAATCCATTTTATGTGGG + Intergenic
966769784 3:183493433-183493455 ATGTACAACACAGTCATTGTAGG - Intronic
967473031 3:189885024-189885046 ATGTATAATTCAAATTTTGGAGG - Intronic
967620625 3:191629470-191629492 ATTTCTACTACAGTATTTGTTGG + Intergenic
970939218 4:21611738-21611760 ATGTACCATACATTTTTTGGAGG + Intronic
971604218 4:28636615-28636637 ATAGAAAATACAGTATTTGTGGG - Intergenic
971745498 4:30574602-30574624 ATGGATAATCCAATCTTTGTGGG + Intergenic
972113268 4:35593184-35593206 ATTGAAAATACAGTATTTGTGGG + Intergenic
972637489 4:40897201-40897223 ATTAATAATACTGTTTTTGCCGG + Intronic
972722957 4:41719161-41719183 ATGTTTAATTCAGTTTTTCCAGG - Intergenic
973180273 4:47258550-47258572 ATGTAGAAAACAGTTTTTGTAGG + Intronic
973965296 4:56155770-56155792 GTATAGAATACAGTTTGTGTAGG + Intergenic
974389747 4:61250854-61250876 ATTTATAATACTCTTTTTATAGG + Intronic
974528166 4:63072794-63072816 CTTTATAATTCAGTTTTGGTAGG - Intergenic
974790687 4:66684185-66684207 ATGTACAATTCAGTTTCTGTAGG - Intergenic
975288459 4:72648104-72648126 ATGAAAAATACAGTCTTTTTCGG - Intergenic
975296510 4:72740601-72740623 ATTTATCGCACAGTTTTTGTGGG - Intergenic
975453205 4:74554716-74554738 GTGTATAAAACAATATTTGTAGG - Intergenic
976348912 4:84038105-84038127 AAGTTTAATACATTTTTTATGGG + Intergenic
977806666 4:101307649-101307671 AAGTATAAAACAGTTTTTGGTGG + Intronic
978788204 4:112633747-112633769 TTGGATAAAACTGTTTTTGTGGG + Intronic
979231987 4:118356327-118356349 ATGTATAACACAGTTGCCGTGGG - Intergenic
979313740 4:119234890-119234912 ATCAAAAATACAGTGTTTGTGGG - Intronic
979532336 4:121781937-121781959 ATGTATAAAACAATTTCTTTTGG - Intergenic
979572474 4:122244401-122244423 ATTCAGAATACAGTATTTGTGGG - Intronic
980095687 4:128488089-128488111 ATGTATATCACATTCTTTGTAGG - Intergenic
980834036 4:138168101-138168123 ATGGACAATGCAGATTTTGTGGG + Exonic
980834454 4:138173774-138173796 GTGTAAAATACAGTTTATTTAGG - Intronic
981609225 4:146575260-146575282 ATGTTGGATACAGTTGTTGTAGG - Intergenic
981696027 4:147559573-147559595 AGGTATAATAAAATTGTTGTTGG + Intergenic
982466299 4:155737328-155737350 ATGTATAATATGAGTTTTGTTGG - Intergenic
982671738 4:158328493-158328515 ATGTATAATACAATTGCTGAAGG + Intronic
982955232 4:161756818-161756840 ATTCAAAATACAGTTATTGTTGG - Intronic
983344269 4:166506562-166506584 ATGGATAATACATTTGTAGTTGG + Intergenic
983533857 4:168836918-168836940 ATATATAACATGGTTTTTGTGGG + Intronic
983799614 4:171910404-171910426 ATATATTATACAGTTGTTATTGG - Intronic
984129286 4:175853059-175853081 CTGTATAATCAGGTTTTTGTGGG - Intronic
984490703 4:180431252-180431274 ATCTATAAGATAGTTGTTGTGGG + Intergenic
984513975 4:180715513-180715535 ATGTATAATACAATTTATTTTGG - Intergenic
986621172 5:9676787-9676809 ATGAAAAAAACAGTTTTGGTGGG + Intronic
987327498 5:16825660-16825682 ATGTATAATACCCATTTTGAGGG - Intronic
987860684 5:23483850-23483872 ATTCATAATACTGTTATTGTAGG + Intergenic
988091696 5:26550035-26550057 ATTCATAATTCAATTTTTGTAGG - Intergenic
988247563 5:28707030-28707052 ATGTAAAATACAGATTTCCTGGG - Intergenic
988643273 5:33065477-33065499 ATTTATAATAGTGTTTTTGGAGG - Intergenic
989091640 5:37739945-37739967 ATGTAAAATAGAGGGTTTGTTGG + Intronic
989452360 5:41601714-41601736 ATATATATTACATTTTTTGGTGG - Intergenic
989773175 5:45169183-45169205 TTCTATAATGCAGTTATTGTGGG - Intergenic
989773261 5:45170449-45170471 TTCTATAATGCAGTTATTGTGGG - Intergenic
989829515 5:45897547-45897569 ATGTAGAATACTATTTTTGTGGG + Intergenic
990136401 5:52649744-52649766 CTGTAGAACACAGTTTTTCTAGG - Intergenic
991097236 5:62752336-62752358 ATGTACAATACTATTGTTGTAGG + Intergenic
991542705 5:67747419-67747441 AGGTATATTACACATTTTGTAGG - Intergenic
991664223 5:68981522-68981544 ATGTATAATTAAGTTATTATTGG - Intergenic
992301290 5:75383785-75383807 ATGTTTAATACTGTTTTTGGTGG + Intronic
992987848 5:82251720-82251742 ATCAATAATAGTGTTTTTGTTGG + Intronic
993295027 5:86126500-86126522 ATGTGTTATTCAGTTTTTATGGG + Intergenic
993334342 5:86638579-86638601 ATTTAATACACAGTTTTTGTGGG - Intergenic
993605914 5:89990692-89990714 ATGGGAAATACAGTTTTTTTTGG - Intergenic
995144972 5:108777436-108777458 ATGTAAACTACAGTCTTTGGGGG - Intronic
995173709 5:109148717-109148739 ATGTAAAATACTTTTTTTCTTGG + Intronic
995926270 5:117378921-117378943 ATGTTTTATACAGTTTATTTAGG + Intergenic
995964334 5:117885723-117885745 CTGAATAATACACTTTTGGTGGG + Intergenic
996015248 5:118526357-118526379 ATATATAATTAAGGTTTTGTAGG + Intergenic
996244187 5:121240049-121240071 ATGTATCATACTGTTTTCATTGG + Intergenic
996948492 5:129097050-129097072 ATGTATAGTTCACTTTTTTTTGG + Intronic
997628834 5:135350837-135350859 ATGTAGAAGTCAGTGTTTGTCGG + Intronic
997704634 5:135936472-135936494 TTGTTTAATACAATTTTAGTAGG - Intronic
998315210 5:141176855-141176877 ATGTACAATGAAGTATTTGTGGG + Intergenic
998319138 5:141212921-141212943 ATGTATAATGACGTATTTGTGGG + Intergenic
998345859 5:141462794-141462816 ATGTCTAATAATGTTTTTATTGG + Intronic
1000174127 5:158733953-158733975 ATGTTTAATATATTTTTTGTGGG - Intronic
1000897219 5:166869570-166869592 ATTTTTAAAACAGTTTTTGAAGG + Intergenic
1002966750 6:1974285-1974307 GTGTATCACACAGTTCTTGTTGG - Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003520307 6:6852970-6852992 ATGGAAAATACAGTATTGGTGGG - Intergenic
1003900790 6:10653629-10653651 ATGGAAAATACAGTATTTGTGGG - Intergenic
1005096074 6:22117920-22117942 AGGTAGAATACAGTTTTAATAGG + Intergenic
1005250940 6:23945347-23945369 ATGTTTTATGCAATTTTTGTTGG - Intergenic
1005524141 6:26629032-26629054 ATGGAAAATACAGTATTTGTGGG + Intergenic
1005694282 6:28336527-28336549 TTTTATAATAAAGTTTCTGTTGG + Intronic
1007003861 6:38341343-38341365 GTGTATAATAAAGTATTTATAGG + Intronic
1007555171 6:42759727-42759749 ATTTATAAAACAGATCTTGTAGG - Intronic
1008204235 6:48633581-48633603 ATTTATAAAACACTTTTTGAAGG + Intergenic
1009473116 6:64053078-64053100 ATTTATCATACATATTTTGTGGG + Intronic
1009796312 6:68472863-68472885 ATGTATATCACACTTTTTATTGG + Intergenic
1010183588 6:73116965-73116987 CAGTATAATTCAGTTTTTTTGGG - Intronic
1010299980 6:74248460-74248482 ATCTATACTAAAGATTTTGTGGG + Intergenic
1010383679 6:75253163-75253185 TTGTATGACACATTTTTTGTTGG - Exonic
1012266066 6:97144387-97144409 ATCTAAAATACAGTATTTGTGGG - Exonic
1014425004 6:121293613-121293635 ATTTAAAATACAGTTTCTGCAGG + Intronic
1015579918 6:134713340-134713362 AAGTATAAAATAGTATTTGTTGG + Intergenic
1016503656 6:144751614-144751636 ATGGAAAATACAGTATTTGCAGG - Intronic
1020541863 7:9468796-9468818 ATTTTTAATACTGTTTATGTGGG - Intergenic
1020697919 7:11438694-11438716 AGCTAACATACAGTTTTTGTAGG - Intronic
1020708450 7:11574734-11574756 ATGTATGATAATGTTTTTGTTGG - Intronic
1022158463 7:27683718-27683740 ATCTATAAAACAATTATTGTTGG - Intergenic
1022209040 7:28190580-28190602 TTGTATAAGCCAGTTTGTGTTGG + Intergenic
1022791454 7:33693326-33693348 CTGAAGAAAACAGTTTTTGTTGG - Intergenic
1023069114 7:36411030-36411052 GTGTAAAATACAGCTTTTGATGG + Intronic
1023653434 7:42394527-42394549 ATATATAATTAAGTTTTTGAGGG + Intergenic
1024948825 7:54837634-54837656 ATAGATAATACTGTTTTTGCTGG + Intergenic
1027035750 7:74923978-74924000 ATCTATAATATGGTTTTTGGAGG + Intergenic
1027345511 7:77255529-77255551 ATTTACAATACAGATTTTATGGG + Intronic
1027873354 7:83738628-83738650 ATTTCTAAAAGAGTTTTTGTTGG + Intergenic
1028166207 7:87540838-87540860 ATGTTTCCTACATTTTTTGTTGG + Intronic
1028256746 7:88608433-88608455 CTTTATAATAGTGTTTTTGTGGG - Intergenic
1028259321 7:88641370-88641392 ATGTATAAAGCAATTTCTGTAGG - Intergenic
1028420174 7:90623986-90624008 ATTTATAATACATATTTTGTAGG + Intronic
1028716708 7:93979332-93979354 ATGTATAAAACATTTTAAGTTGG - Intronic
1030418388 7:109274394-109274416 GTGTTTAATACATTTTTAGTTGG + Intergenic
1030645313 7:112054606-112054628 ATGTATTTTTCAGTTCTTGTAGG + Intronic
1030832037 7:114236262-114236284 ATATATAATGAAGTTTCTGTAGG + Intronic
1031299029 7:120041344-120041366 ATGTATAGTACCATTTTTATGGG + Intergenic
1031807419 7:126325283-126325305 TGGTATAATACAGTTTCAGTGGG + Intergenic
1031927201 7:127650282-127650304 ATTTATCTCACAGTTTTTGTGGG - Intergenic
1032045221 7:128601070-128601092 AGGTATCATCCAGTTTTTCTGGG + Intergenic
1033866958 7:145701091-145701113 ATCTCTAATACATTATTTGTGGG - Intergenic
1035186215 7:157127920-157127942 CTGTTTAATACACTTTCTGTAGG - Intergenic
1035603011 8:908982-909004 ATGTATAATACAGACAATGTTGG - Intergenic
1036069910 8:5429902-5429924 ATAAAAAATACAGTATTTGTGGG - Intergenic
1038041063 8:23724688-23724710 ATGTTTTATACATTTTTTGGTGG + Intergenic
1038099493 8:24357219-24357241 AATTATCATACAGTTTCTGTGGG - Exonic
1039462500 8:37756837-37756859 TTATAAAATTCAGTTTTTGTAGG + Exonic
1039930790 8:41986564-41986586 ATATATAAAACACTTTCTGTGGG - Intronic
1040691846 8:49948288-49948310 ATACATAAAACAGTTTTTGGAGG - Intronic
1041136658 8:54766282-54766304 ATGTAAAATACAATTTTTATAGG + Intergenic
1041284444 8:56245747-56245769 ATGGAAAATACAGTATTTCTGGG + Intergenic
1041479419 8:58301963-58301985 AAATATAATACATTTTTGGTGGG + Intergenic
1042408576 8:68435102-68435124 ATGAATAATACATATTTTATTGG - Intronic
1042441719 8:68835544-68835566 ATTTGTAAAACAGATTTTGTTGG - Intergenic
1042898206 8:73693954-73693976 ATTTGAAGTACAGTTTTTGTAGG - Intronic
1043336618 8:79183943-79183965 ATCTATAATACAATATTTGGTGG - Intergenic
1043501602 8:80863335-80863357 ATGTGAAATACAGTTTTCATAGG - Intronic
1043882500 8:85561297-85561319 ATGACTATTACAGTTATTGTAGG + Intergenic
1044152223 8:88795493-88795515 ATGTATAATATAATTATTGGAGG + Intergenic
1044367195 8:91362077-91362099 ATCTTAAATACAGTGTTTGTTGG + Intronic
1047048087 8:121077625-121077647 TTCTATAATACACCTTTTGTGGG - Intergenic
1047619109 8:126588369-126588391 ATATATAAGACAGTTTATATAGG + Intergenic
1049049996 8:140187178-140187200 GTGGAAAATACAGTATTTGTGGG + Intronic
1050870685 9:10565084-10565106 ATGTATATCACAGTGTCTGTAGG - Intronic
1050874652 9:10618747-10618769 ATGCATAATGCAGTTATTTTAGG - Intergenic
1050915762 9:11129378-11129400 ATGTATAATACACATGATGTTGG + Intergenic
1051055932 9:12985790-12985812 ATGCATAATTCAGCTTTTTTTGG - Intergenic
1053195337 9:36113465-36113487 AAGAATAATACAGGTTGTGTTGG + Intronic
1055691488 9:78836552-78836574 ATATCTAATTCAGTTTTTCTTGG - Intergenic
1056339787 9:85615836-85615858 ATGTATAATAATGTTTATCTCGG + Intronic
1056448250 9:86687742-86687764 ATTTATTATAGTGTTTTTGTGGG + Intergenic
1057820643 9:98327920-98327942 ATGTATAATATACTTTTAGCAGG - Intronic
1057958483 9:99432158-99432180 ATTTATCATACAGTTTCTGAGGG + Intergenic
1058154182 9:101493833-101493855 AGGAATAAGGCAGTTTTTGTTGG + Intronic
1058193626 9:101948224-101948246 ATGTATAATAAGGTTATTGGAGG - Intergenic
1058559139 9:106205032-106205054 ATCTGTAATGCATTTTTTGTAGG + Intergenic
1059051332 9:110929955-110929977 ATGTATAGTTCTGTTTTTGAGGG - Intronic
1059198065 9:112389558-112389580 AGGTATTATACATCTTTTGTTGG - Intronic
1061440152 9:130596943-130596965 ATGTACAATTAAGTTATTGTTGG + Intronic
1186013499 X:5164864-5164886 ATCTGTAATACACTTTTTATTGG - Intergenic
1187489014 X:19732463-19732485 ATAGATAATACAGCATTTGTGGG - Intronic
1187935955 X:24336113-24336135 ATGTTTCAGTCAGTTTTTGTTGG + Intergenic
1187967694 X:24628960-24628982 ATAAATGATACAGCTTTTGTAGG - Intronic
1188636745 X:32442880-32442902 AACTATAATATAGTTTTTTTAGG - Intronic
1188775955 X:34218690-34218712 GTGTATAATACATTTAATGTTGG + Intergenic
1189722191 X:43931626-43931648 CTGTATAATGGATTTTTTGTGGG - Intergenic
1190138780 X:47822093-47822115 ATCTCTTATACAGTTTTGGTGGG + Intergenic
1190231770 X:48587694-48587716 ATGTATAATTAAATTTTTATTGG + Intergenic
1190533485 X:51404744-51404766 ATATAGAATACAGTTTATGAAGG - Intergenic
1190561771 X:51693545-51693567 ATTTATAATTCTGTTTGTGTAGG - Intergenic
1191274880 X:58532239-58532261 TTGTGTAATACTCTTTTTGTAGG + Intergenic
1191593322 X:62913011-62913033 ATGTAAAAGACAGTGATTGTGGG - Intergenic
1193369363 X:80675993-80676015 ATTTATACTACAGTTTTTTGGGG - Exonic
1193888406 X:87011768-87011790 TTGTATAATAAACTTTTTGTGGG - Intergenic
1193946012 X:87735767-87735789 ACTTATAACACAGTCTTTGTAGG - Intergenic
1194249479 X:91556856-91556878 ATGCATAAAACAGATTTTCTAGG - Intergenic
1194285848 X:92009011-92009033 CTGTAAAATAAAGTATTTGTGGG - Intronic
1194491390 X:94554348-94554370 CTGAATAATACAGATTTTGGTGG + Intergenic
1194517489 X:94873888-94873910 ATTTATAATTCTGTTTTAGTAGG - Intergenic
1195460673 X:105120198-105120220 ATGTATCATACAGGTTTTGCTGG - Intronic
1197026812 X:121760895-121760917 ATGAATAACATAGATTTTGTGGG + Intergenic
1197307909 X:124866001-124866023 ATATATAAAACAGATATTGTTGG + Intronic
1200568437 Y:4798071-4798093 ATGCATAAAACAGATTTTCTAGG - Intergenic
1202033303 Y:20602669-20602691 ATTTATCAAACAGTTTTTGGTGG - Intergenic
1202296354 Y:23361753-23361775 ATTTAAAATACAGTTATTGTGGG - Intergenic
1202574453 Y:26308843-26308865 ATTTAAAATACAGTTATTGTGGG + Intergenic