ID: 923084992

View in Genome Browser
Species Human (GRCh38)
Location 1:230696509-230696531
Sequence CCTTCAGGGGGAGCACGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923084992_923085007 23 Left 923084992 1:230696509-230696531 CCGGGCCGTGCTCCCCCTGAAGG No data
Right 923085007 1:230696555-230696577 CTCCAGCGTCCTGTGGCTGGAGG No data
923084992_923085003 16 Left 923084992 1:230696509-230696531 CCGGGCCGTGCTCCCCCTGAAGG No data
Right 923085003 1:230696548-230696570 TCGCCTCCTCCAGCGTCCTGTGG No data
923084992_923085005 20 Left 923084992 1:230696509-230696531 CCGGGCCGTGCTCCCCCTGAAGG No data
Right 923085005 1:230696552-230696574 CTCCTCCAGCGTCCTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923084992 Original CRISPR CCTTCAGGGGGAGCACGGCC CGG (reversed) Intergenic