ID: 923085821

View in Genome Browser
Species Human (GRCh38)
Location 1:230703108-230703130
Sequence CCTTGCCAGGCACTGTGTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923085817_923085821 -1 Left 923085817 1:230703086-230703108 CCTCAAAGGCCAGGGGCAGAGGC 0: 1
1: 1
2: 7
3: 78
4: 648
Right 923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG 0: 1
1: 0
2: 4
3: 35
4: 282
923085809_923085821 28 Left 923085809 1:230703057-230703079 CCGGGGTTGTTATCTGCTGCTGG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG 0: 1
1: 0
2: 4
3: 35
4: 282
923085815_923085821 5 Left 923085815 1:230703080-230703102 CCTTTGCCTCAAAGGCCAGGGGC 0: 1
1: 0
2: 2
3: 15
4: 189
Right 923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG 0: 1
1: 0
2: 4
3: 35
4: 282
923085818_923085821 -10 Left 923085818 1:230703095-230703117 CCAGGGGCAGAGGCCTTGCCAGG 0: 1
1: 1
2: 8
3: 64
4: 540
Right 923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG 0: 1
1: 0
2: 4
3: 35
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923085821 Original CRISPR CCTTGCCAGGCACTGTGTTC TGG Exonic
900097074 1:944133-944155 CCTTCCCAGCCTCTGTGTTGAGG + Exonic
900608123 1:3532836-3532858 CTGTGCCAGGCCCTGGGTTCTGG + Intronic
900630900 1:3634635-3634657 TCGTGCCAGGCACTGTGCTCTGG - Intronic
900653521 1:3743177-3743199 CTTTGCTAGGCACTTTGATCCGG - Intergenic
902273845 1:15325484-15325506 CCTTACCAGGCAGTGTGACCAGG + Intronic
902623525 1:17664095-17664117 CCATGCCATGCACTGGGTGCTGG - Intronic
902885999 1:19405243-19405265 TGTGGCCAGGCACTGTGTTAGGG + Intronic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
905318944 1:37101967-37101989 CTATGCCAGGCACTGAGTTAGGG - Intergenic
905924134 1:41737919-41737941 ACTTGCCAGGCCCTGTGCTGGGG + Intronic
906303635 1:44702180-44702202 ACATGCCAGCCACTGTGTTAGGG + Intronic
906528438 1:46509833-46509855 CTTAGCCAGGCTCTCTGTTCAGG + Intronic
906704727 1:47886711-47886733 CACTGCCAGGCCCTGTGTTAGGG + Intronic
907392789 1:54169142-54169164 CCGTGCCAGGTGCTGTGTTTGGG + Intronic
907427291 1:54388423-54388445 CCAGGCCAGGCACTGTGTGTGGG - Intronic
907944940 1:59127320-59127342 CAGTGCCAGGCACTGTGCTATGG + Intergenic
907944984 1:59127735-59127757 GTTTGCCAGGCACTGTGCTATGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
908888493 1:68817364-68817386 CTTTGCCAGTCACTGAGTTTTGG - Intergenic
909277801 1:73710168-73710190 CCTTGCCTGGCATTGTGCTGTGG + Intergenic
911524371 1:98966113-98966135 TCTAGCCAGGCATTGTTTTCTGG - Intronic
912381353 1:109249746-109249768 CCTTGCCGGGCCCCGGGTTCCGG - Intergenic
912429035 1:109619594-109619616 TCGTGCCAGGCACTGTGTAAAGG + Intronic
913075950 1:115340431-115340453 ATATGCCAGGCACTGTGTGCTGG + Intergenic
915090414 1:153420223-153420245 CCAGGCCAGGCAGTGTGTTATGG + Exonic
915443543 1:155961748-155961770 CCTTGCCAGGCACTGGGGTTTGG + Exonic
916996458 1:170307009-170307031 CCTTTCCAGTAACTGTGTTCTGG - Intergenic
917635064 1:176927656-176927678 ACATGCCAGGCACTGTGTCAGGG + Intronic
918311963 1:183291383-183291405 CCTAGCCAGGCCCTGTGCCCTGG + Intronic
920441985 1:205986845-205986867 CCTCGGCCTGCACTGTGTTCTGG - Intronic
921290475 1:213652233-213652255 ACGTGCCTGGCACTGTGTTAAGG + Intergenic
921580771 1:216893544-216893566 GCTTGCCAGACACTGTGTCTAGG - Intronic
921618264 1:217297464-217297486 GTTTGCCAGGCACTGTGCTAGGG + Intergenic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
924306172 1:242691284-242691306 GCGTGCCAGGCTCTGTGCTCTGG - Intergenic
924402903 1:243706749-243706771 CTCAGCCAGGCACTGTGCTCAGG + Intronic
1063410701 10:5834447-5834469 ACGTGCCAGGGACTGTGCTCAGG + Intronic
1063411452 10:5839756-5839778 ACGTGCCAGGGACTGTGCTCAGG - Intronic
1064585253 10:16833552-16833574 CCTGGCCAGGAAGGGTGTTCTGG - Intronic
1066447194 10:35493974-35493996 CCTGGTCAGGCCCAGTGTTCTGG - Intronic
1069705844 10:70458704-70458726 CCTGCCCAGGCCCTGTGGTCGGG + Intergenic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1070540103 10:77409570-77409592 CCTAGCCTGGTACTGGGTTCAGG + Intronic
1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG + Intergenic
1070788712 10:79177116-79177138 CCCTGCCAGGCGCTGTGAGCAGG - Intronic
1076434763 10:130432503-130432525 CTCTGCCAGGCACAGTGTCCAGG - Intergenic
1076837672 10:133029272-133029294 CGTTCCCAGGCTCTGGGTTCGGG + Intergenic
1077068796 11:657780-657802 CCTGGCCAGGCAGTTTGTCCAGG - Intronic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078659344 11:13274509-13274531 GTATGCCAGGCACTGTGTTAAGG + Intergenic
1078909353 11:15716802-15716824 ATTTCCCAGGCACTGAGTTCAGG + Intergenic
1078924694 11:15864085-15864107 CCCTGCAAGGCACTATGCTCAGG - Intergenic
1080025484 11:27609615-27609637 CTGTGCCAGGCATTGTGCTCAGG + Intergenic
1080043397 11:27783366-27783388 CATTGCCAGATACTGTGTGCTGG - Intergenic
1081342397 11:41944018-41944040 CCTTGACAGGGACAATGTTCTGG + Intergenic
1081614202 11:44580900-44580922 CCTCCCCAGGCACTGAGCTCAGG - Intronic
1081729932 11:45364270-45364292 CCTTGGCAGGGACTGTTCTCAGG + Intergenic
1082928048 11:58571743-58571765 ACATGCCAGGCACTGTGCTCAGG + Intronic
1084091137 11:66880029-66880051 CCGTGCCTGGCATTGTGTGCGGG - Intronic
1084448193 11:69216566-69216588 CCTCGCCAGGCTCTGTGTGAAGG - Intergenic
1085215107 11:74822886-74822908 GTATGCCAGGCACTGTGTTAGGG + Intronic
1085374276 11:76044343-76044365 CCATGTCAGGCTCTGTGTGCTGG - Intronic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1088452387 11:109996090-109996112 CCCTACCAGGGACTCTGTTCAGG - Intergenic
1090607557 11:128437134-128437156 GCTTGCCAGGCACTCTGTTCTGG + Intergenic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092289751 12:7152681-7152703 ATGTGCCAGGCACTGTGCTCGGG + Intronic
1092936474 12:13368498-13368520 CCTTGCCAGGGACTGGGTGCAGG + Intergenic
1093066593 12:14664881-14664903 CATTCCAAGGCACTGTGTTGGGG + Intronic
1093805797 12:23431569-23431591 CCTTGCTAGACAATGGGTTCAGG - Intergenic
1095736799 12:45566441-45566463 CTGTGCCAGGCATTGTGTTAAGG + Intergenic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1098297283 12:69016966-69016988 CCGTGCCTGGCCCTGTTTTCTGG - Intergenic
1098595244 12:72266642-72266664 CAGTGCCAGGCACTGTGCTAGGG - Intronic
1098634002 12:72758180-72758202 CCTTGTCAGGCAGTGTGTTGTGG - Intergenic
1099195514 12:79610083-79610105 CCTAGCCAGGCACTTTGGTGTGG - Intronic
1099503889 12:83448241-83448263 TCTTGCCAGGCACTGTTCTAGGG + Intergenic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1101427148 12:104597657-104597679 ACTCGCCAGGCACTGGGTTTGGG - Intronic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1105849715 13:24323182-24323204 TCTTGGCAGGCACTGTGGTGGGG - Intergenic
1106433954 13:29707809-29707831 TCTGTCCAGGCACTGTGTGCAGG + Intergenic
1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG + Intergenic
1107197305 13:37667942-37667964 CTGTGTCAGGCACTGTCTTCGGG + Intronic
1108364348 13:49694911-49694933 CCGTGCCAGGTACTGTGCTATGG - Intergenic
1109440907 13:62371911-62371933 CACAGCCAGGCACTGTGTTATGG + Intergenic
1109907569 13:68865208-68865230 CCTTGCAATCCTCTGTGTTCGGG - Intergenic
1110948487 13:81455120-81455142 CCTTGACAGACAATGTGTTTTGG - Intergenic
1112275360 13:98012925-98012947 TCTTGCCAGGCACAGTGCTCAGG - Intronic
1114018095 14:18450510-18450532 ACATTCCAGCCACTGTGTTCTGG + Intergenic
1114669800 14:24403637-24403659 ACATGCCAGGCACTGTTTTAGGG - Intronic
1114797550 14:25733661-25733683 CTTTGCCAGGCACTGCTTTAGGG - Intergenic
1117024795 14:51608456-51608478 TCATGCCAGGCATTGTGTTAAGG - Intronic
1117147402 14:52848828-52848850 CCTTGCAAGGAACTTAGTTCCGG + Intergenic
1117951117 14:61083302-61083324 GCTTGCCAGGTTCTGGGTTCTGG + Intronic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1119442826 14:74640086-74640108 TCTTGCCAGGCACTGGGTTACGG - Intergenic
1121211689 14:92212061-92212083 CCTGGCCAGGCACTGACTGCAGG + Intergenic
1122014685 14:98784701-98784723 CCATGCCAGGCACTGTACTAGGG - Intergenic
1122019612 14:98826777-98826799 TCTTGCCAAGCTGTGTGTTCTGG + Intergenic
1122542216 14:102504933-102504955 CCTGGCCAGGCAATGAGTACCGG + Exonic
1122696027 14:103552641-103552663 CCTTGAAAGGCACTGTGGCCTGG + Intergenic
1122898539 14:104772492-104772514 CCTGCCCAGGCCCTGGGTTCAGG + Intronic
1123056342 14:105572373-105572395 CCTTGGCAGGCAGTGGGTACAGG - Intergenic
1123057589 14:105579434-105579456 CCTTGGCAGGCAGTGGGTACAGG + Intergenic
1123080775 14:105692501-105692523 CCTTGGCAGGCAGTGGGTACAGG - Intergenic
1123081866 14:105699367-105699389 CCTTGGCAGGCAGTGGGTACAGG + Intergenic
1123405032 15:20014392-20014414 CCTTCCCAGGCACTGCTGTCAGG - Intergenic
1123514363 15:21021040-21021062 CCTTCCCAGGCACTGCTGTCAGG - Intergenic
1124218120 15:27826149-27826171 CTTTGCCCGGCACAGTGTTCTGG + Intronic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1128258395 15:66214775-66214797 CCTTGCCACGCACAGGGTACAGG + Intronic
1129354012 15:74975687-74975709 AATTGCCAGGCACGGTGATCTGG + Intronic
1130150756 15:81309776-81309798 ACATGCCAAGCACTGTGCTCAGG + Exonic
1130925060 15:88379160-88379182 ACTTGCCAGGCACTGTGCTATGG - Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132761043 16:1508829-1508851 CCTTCCCAGGACCTGTGCTCAGG + Intronic
1132931452 16:2461048-2461070 CCTTGGCAGGCACCGTGGTCTGG - Exonic
1132932270 16:2464716-2464738 TCTTCCCTGGCACTGTGCTCGGG + Exonic
1133147536 16:3800997-3801019 CTGTGCCAGGCTCTGTGTTCAGG + Intronic
1134661804 16:15989823-15989845 GCATACCAGGCACTGCGTTCAGG - Intronic
1134907421 16:17992486-17992508 TTGTGCCAGGCACTGTGCTCAGG - Intergenic
1135390850 16:22092146-22092168 CTCTCCCAGGGACTGTGTTCAGG + Intergenic
1135503992 16:23020522-23020544 CTTTGCCACTCTCTGTGTTCAGG - Intergenic
1136145989 16:28317101-28317123 CCTTGCCTGACACTGTGTGTGGG + Intronic
1137729200 16:50677461-50677483 CCTTGCCGTGCACTGGGTTATGG + Exonic
1138113929 16:54345355-54345377 CCTTGTCAGGCAATGAATTCAGG + Intergenic
1138444222 16:57053381-57053403 CCCTGCCAGTCACTGTGCTCTGG - Intronic
1140734756 16:77888341-77888363 CCATGCCAGGCACTGGGGTCTGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143765629 17:9135754-9135776 CCTTTCCTGGCAATCTGTTCTGG + Intronic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1146054091 17:29572681-29572703 CCTCACCAGCCACTGTGTCCTGG - Exonic
1146419931 17:32674143-32674165 CCTTGACTGGCACTGTGTGGGGG + Intronic
1146787019 17:35729718-35729740 ACATGCCAGGCATTGTGTTAAGG + Intronic
1147202484 17:38812278-38812300 CATTACCATGCAGTGTGTTCAGG - Intronic
1147556379 17:41481778-41481800 CCTTGCCAGGAAGTCTGTGCAGG + Intergenic
1147645705 17:42032641-42032663 ATTTGCCAGGCACTGTGCCCGGG + Intronic
1147685867 17:42286647-42286669 CCTTGCCATGCACTGACATCTGG - Intergenic
1148209443 17:45799508-45799530 CTTTGCTTTGCACTGTGTTCAGG - Intronic
1148552914 17:48561241-48561263 CCCTGCCAGGCACTGGGCTAAGG - Intronic
1153263425 18:3246000-3246022 CATTGCCAAGCACTGTGGTGGGG - Intergenic
1153484740 18:5585687-5585709 CTTTGCTAGGCACTGTGCTATGG + Intronic
1153846526 18:9054622-9054644 CCTTGCTAGGCACTGTGATTTGG - Intergenic
1157208311 18:45719308-45719330 CCTTGCCATGCTCTTTGTTGAGG - Intergenic
1158428977 18:57366561-57366583 CCTTTGCAGGCACTGTTTTGTGG - Exonic
1160941865 19:1623885-1623907 CAGTGCCAGGCCCTGTGTCCTGG - Intronic
1161609634 19:5234680-5234702 GCGTGCCAGGCACTGTGCTAAGG + Intronic
1162585564 19:11556098-11556120 CCCTGCGAGGCACGGTGCTCAGG + Intronic
1162675148 19:12293362-12293384 CTTTTCCAGGCCCTGTGTTATGG - Exonic
1164485669 19:28653721-28653743 AAATGCCAGGCACTGTTTTCTGG + Intergenic
1164689929 19:30203187-30203209 CCTTGCCAGGAGCCGGGTTCAGG - Intergenic
1165065138 19:33224410-33224432 CCTGGCCAGGGGCTGTGTTCAGG + Intronic
1165863607 19:38922498-38922520 CCATGCCAGGCTCTATGTACAGG + Intronic
1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG + Intronic
1167301164 19:48678572-48678594 CAATGCCAGGCACGGTGCTCAGG - Intergenic
1168179619 19:54652215-54652237 CCTCGCCAGGCACTGACTCCGGG + Intronic
927271625 2:21216345-21216367 TTTTGCCAGGCACTGTGCTAAGG + Intergenic
927526477 2:23745879-23745901 CCTTGCCAAGAACAGTGCTCTGG + Intergenic
927694172 2:25229267-25229289 CCTTACCAGGCCCTGTGCTGGGG - Exonic
932886630 2:75554718-75554740 GGGTGCCAGGCACTGTGTTAGGG - Intronic
933283480 2:80358189-80358211 CCTTGCCACGCACTGTCCTAAGG - Intronic
934851991 2:97707435-97707457 CCATGCCAGGCACAGTGCCCTGG + Intergenic
934926829 2:98388129-98388151 CCTTGCCACGCCCTCTCTTCAGG + Intronic
936076903 2:109407184-109407206 CCTTGCCAGCTTCTCTGTTCTGG + Intronic
936927854 2:117756125-117756147 CTTTGCCAGGGAGTATGTTCTGG - Intergenic
939089488 2:137762246-137762268 CTTTGCCAGGCCCTATGTCCAGG - Intergenic
940539049 2:154987223-154987245 CTTTGCCAGGTCCTGTGTCCAGG - Intergenic
940825227 2:158404103-158404125 CTATACCAGGCACTGTGTTAAGG - Intronic
944130631 2:196344220-196344242 CTTTGCCAGGAACAGTGTTTAGG + Intronic
945010981 2:205463357-205463379 CCTGGCCAGGCACTGCCTTGCGG + Intronic
947015210 2:225611767-225611789 GAATGCCAGGCACTGTGATCTGG - Intronic
948073542 2:235147166-235147188 CCTTGTCATCCAGTGTGTTCAGG + Intergenic
948170631 2:235898969-235898991 CCTTGGCAGGCATTATGTTTAGG + Intronic
948864201 2:240767215-240767237 CCTGGCCAGGCCCTGGGATCTGG - Intronic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1169417710 20:5432138-5432160 CCTTGCCAGTGACTGTGAGCTGG - Intergenic
1170807860 20:19649201-19649223 CTCTGCCAGGAAATGTGTTCAGG + Intronic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172789167 20:37490679-37490701 CCTTGGCAGGAACTGTTTTGGGG - Intergenic
1172875345 20:38160743-38160765 CCCAGCCAGGCACTGGGATCAGG - Intronic
1173332768 20:42088853-42088875 CCATGCCTGGCACTGTGGTAAGG - Intronic
1174060259 20:47827355-47827377 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174071638 20:47904015-47904037 CTGTGCCAGGCACTGCGCTCAGG + Intergenic
1174152411 20:48494620-48494642 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1175078372 20:56395289-56395311 GTATGCCAGGCACTGTGCTCAGG + Intronic
1175520771 20:59601465-59601487 CCTTGCCAGGGATCTTGTTCAGG + Intronic
1175807125 20:61835853-61835875 TCCTGCCGGGCACTGTGTTAAGG + Intronic
1175888406 20:62304982-62305004 CCTTCCCTGGCAGTGTGTCCTGG + Intronic
1179249108 21:39658022-39658044 CCTTTCCAGGCTCTGTCTGCTGG + Intronic
1179998548 21:44984949-44984971 CCCTGCCAGGGACAGGGTTCAGG - Intergenic
1180442606 22:15381381-15381403 ACATTCCAGCCACTGTGTTCTGG + Intergenic
1180631858 22:17235271-17235293 CCTCGCCAGGTTCTGTGTTTGGG - Intergenic
1182007961 22:26977227-26977249 CTGTGCCAGGCACTGTGATAAGG - Intergenic
1182022035 22:27089515-27089537 CCATGCCAGGCACTGTCCTAGGG + Intergenic
1182114337 22:27746694-27746716 CTGTGCCTGGCACTGTGCTCAGG + Intergenic
1182341452 22:29624538-29624560 CCTTTACAGGCACTTGGTTCAGG + Intronic
1182613288 22:31567367-31567389 GCCTGCCAGGCCCTGCGTTCTGG - Intronic
1183310462 22:37106876-37106898 ACCTGCCAGGCACTGGGTTCTGG + Intronic
1184280639 22:43435522-43435544 CTTTGCCAGGCACTGGGGCCTGG - Intronic
1184739561 22:46419531-46419553 CCATCCCAGGCACTCTGTCCCGG - Intronic
1184914470 22:47559549-47559571 CATTGCCAAGGACTCTGTTCAGG + Intergenic
1184914915 22:47562772-47562794 CCTGGCCAGGCACTGACTTCTGG - Intergenic
1185071726 22:48660211-48660233 CCTTGCCAGGCACTGGGAGATGG - Intronic
1185334584 22:50265899-50265921 CCTGGCCAGGCACTGCTTGCTGG + Intronic
1185334602 22:50265946-50265968 CCTGGCCAGGCACTGCTTGCTGG + Intronic
1185334619 22:50265991-50266013 CCTGGCCAGGCACTGCTTGCTGG + Intronic
1185367776 22:50444865-50444887 CCCTGCCAGGCACCCTGTGCTGG - Intronic
949213504 3:1535876-1535898 CTTTCTCAGTCACTGTGTTCAGG - Intergenic
949541692 3:5037482-5037504 CTGTGCCAGGCACTATGCTCAGG - Intergenic
949772145 3:7590653-7590675 CCTTCCCAGGACCTTTGTTCAGG + Intronic
950121482 3:10484968-10484990 CAGTGCCAGGCACTGTGCCCAGG - Intronic
950180979 3:10912888-10912910 GCGTACCAGGCACTGAGTTCAGG - Intronic
950343800 3:12273210-12273232 CTTTGCCCTGCACTGTGTTAGGG - Intergenic
950423296 3:12911086-12911108 CCTTGCAAAGCACTGTGTTCCGG + Intronic
951356171 3:21669679-21669701 GTTGGCCAGGCACTGTGTTAGGG - Intronic
952978819 3:38718912-38718934 CCCTTCCAGGGACTGTGGTCAGG - Intronic
953016922 3:39086394-39086416 TCCTGCCAGGGACTTTGTTCTGG + Intronic
954383062 3:50229897-50229919 CATTGGCAGGCAATATGTTCAGG + Intronic
955919009 3:63935044-63935066 ACATACCAGGCACTGTGCTCAGG - Intronic
956036752 3:65101682-65101704 CTTTGCCAGGTACTGTGATATGG - Intergenic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
959310623 3:104731264-104731286 CGTTGACAGGCACTGTCTTCTGG - Intergenic
959839729 3:110960309-110960331 CTTAGACAGGCACTGAGTTCTGG - Intergenic
960700516 3:120434840-120434862 CCTTGCCACACACTATGTACAGG + Intronic
961925552 3:130475933-130475955 CCTTGCCAGTGACTCTGTTTTGG + Intronic
962266183 3:133945881-133945903 TCGTGCCAGGCACTGTGCCCGGG + Intronic
962325369 3:134427912-134427934 CCGTGCCAGGTACTGTGGACTGG + Intergenic
962606569 3:137037175-137037197 CCGTGCCAGGCCCTGTGGCCAGG + Intergenic
962938329 3:140102213-140102235 CCTTGGCAGGGGCTGTGTTAGGG + Intronic
964044957 3:152312368-152312390 TCTTGCCACGCATTGTGTTTTGG + Intronic
965072376 3:163931353-163931375 ACATTCCAGGCATTGTGTTCAGG - Intergenic
967141893 3:186568494-186568516 CCATGCCAGGCACTGTTCTAAGG + Intronic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967968871 3:194984875-194984897 CCTTGTCAGGCAAGGTGTCCTGG - Intergenic
968285180 3:197504475-197504497 CCTTGCTGGCAACTGTGTTCTGG - Intergenic
970425378 4:15940953-15940975 GCGTGCCAGGCACTGTGCTAAGG + Intergenic
971288746 4:25315379-25315401 CCTTTCCACACACTGCGTTCGGG - Exonic
971675745 4:29626402-29626424 CCATGCCAGGCACTGTTGTATGG - Intergenic
972361187 4:38326905-38326927 CCTTGCCAGGCAGTGGCTACAGG - Intergenic
973108279 4:46368030-46368052 CATTGCTAGCCACTGTGTCCAGG - Intronic
973177763 4:47228989-47229011 TATTGCCAGGCACTGTGCTGGGG + Intronic
975177779 4:71308226-71308248 CCCTACTAGGCACTGTGTTAGGG - Intronic
976827306 4:89275077-89275099 CTTTGGCAAGCACTGTGTTCTGG + Intronic
977922331 4:102659467-102659489 CTTTGCCAGACTCTGTGTTCTGG + Intronic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
978945707 4:114493713-114493735 CCTTGCCAGTTCCTGTGTTCAGG - Intergenic
980083929 4:128372152-128372174 CCATGCCAGGCACTGCGTTATGG - Intergenic
981004691 4:139862659-139862681 CTTTGCCATGCATTGTGTTCTGG - Intronic
984838522 4:184045733-184045755 CCTTTCAAGTCACTGTGTTCAGG + Intergenic
984989713 4:185368393-185368415 CCATGGCAGGCAGTGTGTTATGG - Intronic
985910720 5:2878592-2878614 CCTTGCCAAGTACTGACTTCTGG + Intergenic
986591347 5:9374147-9374169 ACTTGCCTGACTCTGTGTTCTGG - Intronic
986605582 5:9520224-9520246 CCAGGCCAGGCACTGTTGTCAGG + Intronic
987077588 5:14398417-14398439 CCTTCCCAGACACTCTGCTCAGG - Intronic
988609128 5:32709320-32709342 GGTTGCCAGGCACTGTGCTGGGG - Intronic
991423142 5:66462162-66462184 CAATGCCAGGCACTGTGCTAGGG + Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
995254366 5:110029336-110029358 ACTTGCCAGGCACTGCTCTCGGG + Intergenic
997525421 5:134549910-134549932 CCTTGCCAGGTCCTGTGCTGGGG + Intronic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
1001278617 5:170369560-170369582 CCTTGCCAGGCTCTGTGCCAGGG - Intronic
1002284398 5:178152761-178152783 CTTTTTCAGGCACTGTGTTATGG - Intronic
1003171787 6:3726204-3726226 ACTGGCCAGGCACTGTCTTGGGG - Intronic
1004007556 6:11651052-11651074 TCTGGCCTGGCATTGTGTTCTGG + Intergenic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1007448983 6:41928883-41928905 CAATGCCAGGCACTGAGTTTGGG - Intronic
1007627967 6:43257190-43257212 CTCTGCCAGGCCCTGGGTTCAGG - Intronic
1008075879 6:47145970-47145992 ATTTGCCAAGCACTGTGTTTAGG + Intergenic
1008355718 6:50550571-50550593 CTCTGCCAGGGACTGTGTTTGGG - Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016824098 6:148372646-148372668 CCTTGCCAGGCACTAAGCTCAGG - Intronic
1017842606 6:158233256-158233278 CCTCGCCAGGAACTGTCTCCTGG + Intronic
1017936979 6:159014487-159014509 CCTTTCCAGGCCTTTTGTTCTGG + Intergenic
1018231815 6:161682610-161682632 CATTCTCAGGCACTGCGTTCAGG + Intronic
1018462849 6:164015566-164015588 CCTTGTCTTGCACTGTGTTGGGG + Intergenic
1019746082 7:2701046-2701068 CCATCCCAGGCACTGTGCTGCGG + Intronic
1021978925 7:26035910-26035932 CCATGCCAGGCACTGTTTCCTGG - Intergenic
1022559700 7:31336007-31336029 CTTTCCCTGGCACTGTGTCCGGG - Intergenic
1024633832 7:51270419-51270441 ACGTGCCAGGCACTGTTCTCAGG + Intronic
1026600665 7:71774796-71774818 CCTTGCCTGGCACTGCCTTCTGG + Intergenic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1028738806 7:94248799-94248821 CCTTTCCAGGCACTGTGGCTGGG - Intergenic
1032452354 7:132043931-132043953 TATTGCCAGGCACTGTGCACAGG - Intergenic
1032815600 7:135470486-135470508 CCTGGCCAGGCACAGTGAGCTGG + Intronic
1033046036 7:137962804-137962826 TTGTGCCAGGTACTGTGTTCTGG - Intronic
1035708226 8:1693973-1693995 CCTAGGCAGGCACTGTCTTTAGG + Intronic
1037864610 8:22433273-22433295 GTGTGCCAGGCACTGTGTTAAGG - Intronic
1039437233 8:37568038-37568060 GCATGCCAGGCACTGTGCTGGGG + Intergenic
1039889459 8:41674250-41674272 ACATGCCAGGCACTGTGCTATGG + Intronic
1039969166 8:42306957-42306979 CTGTGTCAGGCACTGTGCTCAGG + Intronic
1040516114 8:48136464-48136486 CCCTGCCAGGCAGTGGGTTAGGG + Intergenic
1041361732 8:57061828-57061850 GTGTGCCAGGCACTGTGTTAAGG - Intergenic
1046273331 8:111924768-111924790 TAATGCCAGGCACTGTGTTAAGG + Intergenic
1046751180 8:117928337-117928359 ACATGCCAGGCACTGTGGACAGG - Intronic
1047416148 8:124666284-124666306 ACATGCAAGGCACTGTGCTCAGG + Intronic
1047689332 8:127335354-127335376 CCTAGCTAGGCTCTGTGTTTAGG + Intergenic
1049167598 8:141136320-141136342 ACCTGCCAGGCCCTATGTTCAGG - Intronic
1049380667 8:142314198-142314220 CCTTGTCAGGCACTGTGCCAGGG + Intronic
1050617575 9:7418369-7418391 CCTTGCCAGGGCCTATGTCCAGG - Intergenic
1050654359 9:7809972-7809994 CCATGCCAGGCTCTGAGTGCAGG - Intronic
1051186642 9:14467317-14467339 CCTGGCCAGACCCTGTGTGCTGG - Intergenic
1052170526 9:25390116-25390138 CCATGCCAGGCCCTGTTTTAAGG + Intergenic
1053268057 9:36730353-36730375 CTGTGCCAGGCACAGGGTTCTGG + Intergenic
1057296975 9:93852040-93852062 GATTGCCTGGGACTGTGTTCTGG + Intergenic
1057567823 9:96180614-96180636 ACTTGCCAGGCAATGTCTTCAGG - Intergenic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1060533633 9:124365190-124365212 CATGGGCAGGCTCTGTGTTCAGG - Intronic
1061154188 9:128847170-128847192 CCCTACCAGGTACTGGGTTCTGG + Intronic
1062190954 9:135247613-135247635 TCCTGCCAGGCACGGTGTGCTGG + Intergenic
1187400199 X:18952603-18952625 GCTTGCCAGCCACAGTGATCAGG - Intronic
1187557026 X:20361835-20361857 CCTTGCAAGGCACTTGTTTCTGG - Intergenic
1189559891 X:42181671-42181693 CCTAGCCAGTCACTGTGTGCTGG - Intergenic
1192331152 X:70176260-70176282 GTTTGCCAGGCACTGTGTTTAGG - Intergenic
1194934452 X:99931466-99931488 CTGTGCCAGGCACTATGTTAAGG + Intergenic
1195964265 X:110416081-110416103 CGTGGCAAGGCACTGTGTTCTGG + Intronic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1198675512 X:139126518-139126540 CCAGGCCATGCCCTGTGTTCTGG - Intronic
1199267769 X:145848282-145848304 ACTTGCCAGGCACTGTTCTAAGG - Intergenic
1200327776 X:155260575-155260597 CCAGGCCAGGCACTGTTTTGTGG - Exonic