ID: 923086332

View in Genome Browser
Species Human (GRCh38)
Location 1:230705984-230706006
Sequence TCTGACCTGGACAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923086332_923086341 9 Left 923086332 1:230705984-230706006 CCCTCCACCTTGTCCAGGTCAGA 0: 1
1: 0
2: 2
3: 19
4: 193
Right 923086341 1:230706016-230706038 AGGCTGGATCAGCAGCAGGCAGG 0: 1
1: 1
2: 1
3: 51
4: 381
923086332_923086339 -7 Left 923086332 1:230705984-230706006 CCCTCCACCTTGTCCAGGTCAGA 0: 1
1: 0
2: 2
3: 19
4: 193
Right 923086339 1:230706000-230706022 GGTCAGAGGCATAGTGAGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 239
923086332_923086342 24 Left 923086332 1:230705984-230706006 CCCTCCACCTTGTCCAGGTCAGA 0: 1
1: 0
2: 2
3: 19
4: 193
Right 923086342 1:230706031-230706053 CAGGCAGGCGCTCTCAGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 128
923086332_923086343 25 Left 923086332 1:230705984-230706006 CCCTCCACCTTGTCCAGGTCAGA 0: 1
1: 0
2: 2
3: 19
4: 193
Right 923086343 1:230706032-230706054 AGGCAGGCGCTCTCAGTGAAGGG 0: 1
1: 0
2: 2
3: 4
4: 115
923086332_923086340 5 Left 923086332 1:230705984-230706006 CCCTCCACCTTGTCCAGGTCAGA 0: 1
1: 0
2: 2
3: 19
4: 193
Right 923086340 1:230706012-230706034 AGTGAGGCTGGATCAGCAGCAGG 0: 1
1: 0
2: 1
3: 30
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923086332 Original CRISPR TCTGACCTGGACAAGGTGGA GGG (reversed) Exonic
901780883 1:11593852-11593874 TCTGGCCTGGGCAGGATGGAGGG + Intergenic
901904559 1:12396688-12396710 TCTGGCCTCGACAATCTGGATGG - Intronic
902241021 1:15089352-15089374 TCTTGCCTGGTCAAGGTGGGAGG - Intronic
903144680 1:21363339-21363361 TCTCACCTGGACCGTGTGGATGG + Intergenic
903491870 1:23735190-23735212 TATGACCTAGACAAGGTCAAAGG - Intergenic
903755107 1:25655196-25655218 TCAGACCTGGAGAAGTTGAAAGG - Intronic
909481816 1:76134376-76134398 TCAGGCCTGGAAAAGGTGAAGGG - Intronic
910264210 1:85321501-85321523 TCTGAACTGGAAAAGGTGGATGG - Exonic
910795450 1:91092934-91092956 TTTGACCTGGTTAACGTGGAGGG + Intergenic
911223324 1:95276120-95276142 TCTGCTCAGGACAAGGTAGAAGG - Intergenic
912529254 1:110308195-110308217 TGGTGCCTGGACAAGGTGGATGG - Intergenic
915076296 1:153310679-153310701 TCTGACCGGGAGAGTGTGGACGG + Exonic
915091653 1:153430321-153430343 TCTGACCTGGACATGGCCCAGGG + Intergenic
915230073 1:154438910-154438932 TCAGACCTGGACAAGGAGTGGGG + Intronic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
916501354 1:165390155-165390177 TCTGCCTTGGGCAAGGTGGAGGG + Intergenic
919277039 1:195433787-195433809 TTTGAAATGGACAAGGTAGAGGG - Intergenic
919474167 1:198013965-198013987 AATGATCTGGACAAGGTAGAGGG + Intergenic
919788377 1:201274691-201274713 TATGACCTGGAAAGAGTGGAGGG + Intergenic
920681566 1:208077133-208077155 TCTGAACAGGACATGGGGGAGGG - Intronic
920777554 1:208954637-208954659 TCTGGCCCGGACAGTGTGGAGGG - Intergenic
923086332 1:230705984-230706006 TCTGACCTGGACAAGGTGGAGGG - Exonic
923413739 1:233734531-233734553 TCTGACCTGCACAAGGATGCAGG - Intergenic
1067694054 10:48523034-48523056 TCTCACCTGGACAAGGTCGAAGG + Intronic
1071394275 10:85206256-85206278 GCTCACCTGGACAAGGAGGCGGG + Intergenic
1076340123 10:129739885-129739907 TCTGATCTGACCAAGGTGTAGGG - Intronic
1078128932 11:8595568-8595590 TCTGCGCTGGACAAGCTGGTAGG - Intergenic
1078545700 11:12245631-12245653 GCTGACCTGGAGCAGGTGGCTGG - Intronic
1079942005 11:26692658-26692680 TCTGCCCTGGACAAGAGGGCAGG - Intronic
1080893520 11:36429734-36429756 CCTCACCTGGACTAGGTGAAAGG + Intronic
1081208785 11:40306490-40306512 TCTCACATGGACAAAGTGTATGG + Intronic
1083630709 11:64093785-64093807 TCTGGCCTGGCCAGGGTGGAAGG + Intronic
1083956692 11:65987753-65987775 TCAGCCCTGGACAAAGTGAAAGG + Intergenic
1084443098 11:69187197-69187219 TATGACCTGGGCAAGCTGGCGGG - Intergenic
1084566591 11:69932112-69932134 TATGGCCTGGACAAGGTGCCTGG - Intergenic
1084756587 11:71243138-71243160 TCTGACTCTCACAAGGTGGAAGG - Intronic
1085019253 11:73194916-73194938 TATGTCCAGGACCAGGTGGAGGG - Intergenic
1085248988 11:75129294-75129316 TGTGAACTAGGCAAGGTGGAGGG + Intronic
1086168304 11:83806108-83806130 CCTGACCTGGACAAGGGAGAAGG - Intronic
1087420472 11:97918871-97918893 TCTGGCCATGCCAAGGTGGAAGG - Intergenic
1089650117 11:119907477-119907499 TCTGGCCTGGACTGGGTGGCTGG + Intergenic
1091448654 12:559339-559361 TCTGACCTGGACAGGATTGGGGG + Exonic
1091648704 12:2293340-2293362 TCTGACTGGGACAAGATGCAGGG + Intronic
1091686679 12:2567427-2567449 TCTGTTCTGGCCGAGGTGGATGG + Intronic
1092238057 12:6822005-6822027 TCTGCCCTGGAGAACCTGGAGGG + Intronic
1096087133 12:48873080-48873102 TCTGTCCTGTGCAAGGTGGGAGG + Intergenic
1096470014 12:51869754-51869776 TGTGACCTATACAAGGTGGGAGG + Intergenic
1097223887 12:57465613-57465635 TCTGAGCTGGACATGCTGGTTGG + Exonic
1099323524 12:81181285-81181307 TCTCACCTGGAGAAGCTGTATGG + Intronic
1101532193 12:105583511-105583533 TCTGCCCAGGAAAAGGTAGAAGG + Intergenic
1110810171 13:79803911-79803933 TTTTACCTGGAGAAGGTTGAGGG - Intergenic
1111276937 13:85962444-85962466 TCTTACTTGGACAAGGTGTATGG - Intergenic
1111350195 13:87018460-87018482 GTTGACCTGGATAAAGTGGATGG + Intergenic
1111933861 13:94538973-94538995 TGTGACCTGGAATAGCTGGAGGG - Intergenic
1117983091 14:61361140-61361162 ACTGATCTGAACAAGGTTGAGGG - Intronic
1121427029 14:93859726-93859748 ACTGACCTGAACAGGGAGGAAGG - Intergenic
1121629091 14:95409518-95409540 TCTCGGCTGGACAAGGTGGTTGG + Intronic
1122743943 14:103887222-103887244 TCTGGGCTGGACACTGTGGAGGG + Intergenic
1123927622 15:25133850-25133872 TTTTACATGGACAAGGAGGAGGG - Intergenic
1127328861 15:57919659-57919681 TCTGACCTGTTCAGGATGGAAGG + Intergenic
1127329005 15:57920767-57920789 TCTGACCTAGATAAGAGGGAAGG - Intergenic
1127642363 15:60928058-60928080 TGTGACCTGGAGAAGATGGGAGG - Intronic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1131324839 15:91432235-91432257 TCTTCCCTGGAGAAGGTGGGTGG + Intergenic
1132574846 16:659610-659632 TCTGACGGGGACAAGGTGCCTGG - Intronic
1133050832 16:3116372-3116394 CATGACGTGGACACGGTGGAGGG - Intronic
1134354077 16:13464830-13464852 TCTGAACTGTAAAAGGTGGGGGG - Intergenic
1134674430 16:16079440-16079462 GCTGAGATGGACAAAGTGGAGGG + Exonic
1135038308 16:19096911-19096933 TCTGATCTGGAAAAGGTGGCTGG - Intergenic
1135424440 16:22325349-22325371 CCGGACCTGGAGAGGGTGGAGGG + Intronic
1136221654 16:28833271-28833293 TTTGGCTTGGACAAGGTGGTGGG - Exonic
1137943763 16:52714450-52714472 TCTGACCTGGAAAATGAGGAGGG - Intergenic
1141058361 16:80840113-80840135 TCTTACCTGGATAGAGTGGAGGG + Intergenic
1143046601 17:4085785-4085807 TCAGTGGTGGACAAGGTGGATGG - Exonic
1145241583 17:21243526-21243548 ACTGACCTGGGCAAAGTGGAAGG - Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148544173 17:48504281-48504303 CCTAACCTGGCCAAGGTGAAAGG - Intergenic
1148825707 17:50392441-50392463 CCTGTCCTGGCCAAGGTGGCAGG - Exonic
1149293550 17:55239888-55239910 CCTAACATGGACAAGGTGGGAGG + Intergenic
1154328100 18:13406662-13406684 TGGGACCTGGACAGGGTGGGAGG + Intronic
1156177431 18:34563313-34563335 TCTCTCCTAGCCAAGGTGGATGG - Intronic
1157126945 18:44965131-44965153 TCAGAATTGGACAAGGGGGAAGG + Intronic
1159258413 18:65978318-65978340 TTTGTCATGGAGAAGGTGGAGGG - Intergenic
1159518578 18:69489179-69489201 TTTAAGCTGGACAAGGTGGGTGG - Intronic
1160769722 19:825144-825166 TTTGGCCAGGACAGGGTGGATGG + Intronic
1162514231 19:11138591-11138613 TCTGGCCAGGACAGGGTGGAAGG + Intronic
1163514489 19:17754869-17754891 TCAGAACTGGACTAGGTGGAGGG - Intronic
1165166966 19:33863622-33863644 TCTGTCCTGGACAAGCGGGTGGG + Intergenic
1166384287 19:42371516-42371538 CCTGACCTCCACAAGGTGTAGGG - Intronic
1166643890 19:44516945-44516967 TCAGTCCTGGTCAAGGTGGTAGG - Exonic
1168553879 19:57322036-57322058 TCTGTCCTGGCTAAGGAGGAAGG - Intronic
925188235 2:1864085-1864107 CCTGACATGGCCCAGGTGGATGG + Intronic
926146701 2:10400827-10400849 TCTGCCCTGGAATTGGTGGAGGG + Intronic
926893923 2:17663142-17663164 TCTGAACTGGTCAAAGTAGAAGG + Intergenic
927520368 2:23694746-23694768 TCTGCCAGGCACAAGGTGGATGG - Intronic
927582946 2:24271055-24271077 GCTGAGCTGTACAAAGTGGAAGG + Intronic
929863831 2:45701008-45701030 TCTGACCTTAACAACTTGGAAGG + Intronic
932780546 2:74556064-74556086 TATGGCCGGGACAAGGTGCAGGG + Exonic
936501927 2:113073393-113073415 TGTGTCCTGGACAAGGTGGGTGG + Intronic
937124770 2:119466924-119466946 TCTGACCAGGAAGAGGTAGAAGG + Intronic
942702230 2:178725649-178725671 TCTGAACAGGAAAAGATGGATGG + Exonic
943138680 2:183950190-183950212 TTTGACCTGGACGACCTGGAAGG + Intergenic
945022900 2:205591980-205592002 TCACACCTAGACAAAGTGGAAGG + Intronic
945998919 2:216464431-216464453 TCTGACTTGGCCAAAGTGAAAGG + Intronic
946531013 2:220570414-220570436 GCTGACAGGGACCAGGTGGACGG - Intergenic
947644598 2:231729141-231729163 TCTGACCTGTACAAGCTGAGAGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948315191 2:237023119-237023141 TCTGACCTGGAAGAGTTGGTGGG - Intergenic
948922006 2:241070248-241070270 TCAGTCCTGAACAGGGTGGAGGG - Intronic
1168880605 20:1203364-1203386 TCTGAACAGAACAAGGAGGAAGG - Intergenic
1169356353 20:4909842-4909864 TCTGACTTGGTCCAGGTGGGTGG - Intronic
1170378861 20:15734056-15734078 TCTGATCTGGGCAAGGGAGAGGG + Intronic
1170724307 20:18912672-18912694 TTTGACCTGAACAATCTGGAAGG + Intergenic
1171090508 20:22281675-22281697 TCTGCCTTGCACAAGGAGGAAGG - Intergenic
1171271643 20:23822902-23822924 TGTGAACTAGGCAAGGTGGAGGG - Intergenic
1174080349 20:47967073-47967095 TTTGCTCTGGACAAGGTGGATGG - Intergenic
1174414167 20:50356363-50356385 TGTGACCTGGGGCAGGTGGATGG + Intergenic
1174738130 20:52984777-52984799 GCTGACTTGGACCAGATGGATGG + Intronic
1174754584 20:53145213-53145235 TCTGATCAGGACATGGTGGGTGG + Intronic
1175201831 20:57283376-57283398 TCTGAGATGGAAAAGGGGGAGGG + Intergenic
1175588755 20:60169961-60169983 GTTGGCCTGGACATGGTGGATGG + Intergenic
1175766691 20:61597456-61597478 TCTGTACTGGGGAAGGTGGAAGG - Intronic
1178090076 21:29153263-29153285 TCTGTCCAGGAGTAGGTGGAAGG + Intronic
1179047235 21:37856824-37856846 TCTGACCTGGGGAAGTTGTATGG + Intronic
1180742123 22:18061117-18061139 TCTGATCTGGAAAAGGGGCAGGG + Intergenic
1180926282 22:19557305-19557327 ACTGACCTGATGAAGGTGGAGGG + Intergenic
1182079196 22:27517316-27517338 TCCAACCTGAACAAGGGGGATGG + Intergenic
1183241424 22:36660622-36660644 CCTCACCTGGGCAAGGTGGGGGG - Intronic
1185331658 22:50254759-50254781 TCTGGCCTGGACATGGCGGAAGG + Intronic
950043687 3:9936056-9936078 TCTGACTTTGAAAAGCTGGAGGG - Intronic
952526011 3:34211318-34211340 TCTGCCCTCCACAAGGAGGAAGG - Intergenic
953644611 3:44742491-44742513 TCTGACCTTTACAAAGTGGGAGG + Intronic
954132061 3:48565970-48565992 CCTGACCTGGACCCGGTGGGAGG - Intronic
957163988 3:76647045-76647067 TCTGACCTTGAAAAAGGGGAGGG + Intronic
961994615 3:131228877-131228899 TCTGATCTGGACCATGTTGATGG + Intronic
965654109 3:170965469-170965491 TCTGAGCTGTACAAAGTTGATGG - Intergenic
965681022 3:171251490-171251512 TCTGTCCTGGGCAAGTTGGCTGG + Intronic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
968120005 3:196119554-196119576 TCTGACCTGGACCCGCTTGATGG - Intergenic
968964780 4:3764365-3764387 TGTGACCTGGGGATGGTGGAGGG - Intergenic
970186191 4:13455840-13455862 TCTGATCTGGACAGGGGAGATGG + Intronic
973856297 4:55013684-55013706 TCTGGCCTGAAGAAGCTGGATGG + Intergenic
975326273 4:73062247-73062269 TCTTAACTGGCCTAGGTGGAAGG + Intronic
975582064 4:75915771-75915793 TTAGATCTGGGCAAGGTGGAGGG - Intronic
979267581 4:118721198-118721220 TCTGACCTGGTCTAGCTGGGGGG - Intergenic
982261952 4:153501898-153501920 AGTGACCTGGAAAAGGTAGAGGG - Intronic
983546275 4:168967692-168967714 TCTGTACTGGAGCAGGTGGATGG + Intronic
985332613 4:188856436-188856458 TCTGGCCTGGATAAAGAGGATGG + Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
986367587 5:7048864-7048886 TCTGTTCTGGACAATGAGGAAGG + Intergenic
986966694 5:13281418-13281440 TCTGACCTGGGTAATGTGGCAGG - Intergenic
987938157 5:24496409-24496431 TCTGAGATGGAAAAGGTGAAGGG + Intronic
988293908 5:29329967-29329989 TGAGACCTGGCCAAGGTGGGTGG - Intergenic
992896065 5:81246058-81246080 TCTCACCTGGACAATGTCTAGGG + Intronic
996588864 5:125122887-125122909 TTTGAGATGGCCAAGGTGGATGG - Intergenic
997053894 5:130416973-130416995 TCAGAGCTGGAAAAGGGGGATGG + Intergenic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
999230210 5:150057366-150057388 CTAGACCTGGACAAGGAGGATGG - Exonic
999268715 5:150283901-150283923 TCTGTGCTGGAGAAGGTTGAGGG - Intronic
999977322 5:156924580-156924602 TCTGACCTGCACAAACTCGATGG - Intronic
1002856835 6:1045379-1045401 TCTGACCTGGACATGGTCAAGGG + Intergenic
1002859081 6:1064192-1064214 CCTGACTTGGAAAAGGAGGAAGG - Intergenic
1006185707 6:32180546-32180568 TCTGCCCTGGGGAAGGAGGATGG + Exonic
1007186441 6:39976178-39976200 TCTGAGTTTGATAAGGTGGAAGG + Intergenic
1007196610 6:40066868-40066890 TCTGACTAGGACACTGTGGAGGG + Intergenic
1007593765 6:43038982-43039004 TCTGACCTGGACCAGGAAGGGGG + Exonic
1013808671 6:114020326-114020348 CCTGACTTGGCCAAGGTGGTGGG - Intergenic
1017809985 6:157977609-157977631 CCAGACCTGCACATGGTGGAAGG - Intergenic
1019740124 7:2668630-2668652 GCTGTCCTGGACCAGCTGGAGGG - Intergenic
1021627648 7:22610104-22610126 AGCGACTTGGACAAGGTGGATGG - Intronic
1022044337 7:26611248-26611270 TCAGATGTGGACAGGGTGGATGG - Intergenic
1022283783 7:28935757-28935779 TCTGACCAGGACAAGAAGGGCGG + Intergenic
1022500390 7:30878887-30878909 TCTGACCTGGTGAAAGTGGATGG - Intronic
1022969748 7:35505948-35505970 GCTCCCCTGGACGAGGTGGATGG + Intergenic
1023475491 7:40573429-40573451 TCACACCTGGGTAAGGTGGATGG - Intronic
1023669052 7:42556839-42556861 ACTGAACTAGACAATGTGGAGGG + Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1025256316 7:57385849-57385871 TGTGACCTGGAGCAGGTGGAGGG - Intergenic
1025947713 7:66117144-66117166 TCTGAATTTGACAAGATGGAGGG - Intronic
1026968545 7:74454592-74454614 CCAGACCGGGAGAAGGTGGAGGG - Intronic
1029313979 7:99694607-99694629 ACTGACCTAGAAAAGGTGGCGGG + Intronic
1029322673 7:99778853-99778875 GTTGACCTGGAAAAGGTGGCGGG + Intronic
1029482699 7:100822784-100822806 TGTGCCCTGGGGAAGGTGGAGGG - Intronic
1031170438 7:118286248-118286270 TCTGACCTGGGGAAGGTTTAAGG - Intergenic
1031958087 7:127963102-127963124 TCTGACCTGAACAAGGAGATTGG + Intronic
1032046072 7:128609535-128609557 TCTGACCTAGAGAAGAGGGAGGG + Intergenic
1032119981 7:129148652-129148674 TCTGACCTGGCTTAAGTGGAGGG - Intronic
1035666411 8:1383666-1383688 TCAGCCCTGGGCCAGGTGGACGG - Intergenic
1036690713 8:10943091-10943113 TCTGACCTGGGCAGAGTGAATGG - Intronic
1038021535 8:23555368-23555390 TCCAACCTGGAGAAGGTGGCTGG - Intronic
1039572706 8:38600419-38600441 TCTGCCCTGGGGAAGGAGGATGG - Intergenic
1041288996 8:56290614-56290636 TCTGTCCTGGAGATGGTGGGTGG + Intergenic
1044191679 8:89326453-89326475 TTTGACAAGGACAAGGGGGAAGG - Intergenic
1045417927 8:101985339-101985361 TCTGAGCTGGTCCAGGTGGGAGG - Intronic
1045611453 8:103847656-103847678 ACTGGCCTTTACAAGGTGGAAGG + Intronic
1048975095 8:139667017-139667039 TGAGAGCTGGACAGGGTGGACGG - Intronic
1049408137 8:142460733-142460755 TCTGGCCTGGAGAGGGAGGAGGG - Intronic
1049432524 8:142571866-142571888 TTTGAGCTGGGCATGGTGGAGGG - Intergenic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1051132278 9:13875780-13875802 TCTGACCTGGGCAGGTTAGAGGG + Intergenic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1057504085 9:95618332-95618354 TGTCACCTGGAAAATGTGGAGGG - Intergenic
1057964196 9:99487599-99487621 GCTGACCGGCACAGGGTGGAAGG - Intergenic
1058415042 9:104778605-104778627 TGTGACCTGAACTAGGTAGATGG - Intergenic
1058479192 9:105373543-105373565 TCTGACCTGAACAAGGGAGAGGG + Intronic
1060597558 9:124857347-124857369 TTTGACCTGGAAAAGGAGGGGGG - Exonic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1062105357 9:134752250-134752272 TCTGACCTAGCCAAGGGTGATGG + Intronic
1185822248 X:3216831-3216853 TCAGACCTGGAGAAGATGGAAGG + Intergenic
1188642513 X:32523768-32523790 TATGACCTGTATAAGGAGGAAGG + Intronic
1195023915 X:100856367-100856389 TCTGACTTAGACAAGATGGAAGG + Intronic
1195247490 X:103007664-103007686 TCTAACTTGGCCAAGGTGGTGGG + Intergenic
1196068603 X:111494004-111494026 TCTGACCTAGAAAAGGTTAATGG - Intergenic
1200208963 X:154337293-154337315 TCTTACCTGGACCAGGACGATGG + Intergenic
1200221913 X:154394835-154394857 TCTTACCTGGACCAGGACGATGG - Intronic