ID: 923090251

View in Genome Browser
Species Human (GRCh38)
Location 1:230735235-230735257
Sequence AAATCTCGCCCCGACTGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923090244_923090251 17 Left 923090244 1:230735195-230735217 CCTCACTGAACGCTTCCTTCCAC No data
Right 923090251 1:230735235-230735257 AAATCTCGCCCCGACTGCAGCGG No data
923090245_923090251 2 Left 923090245 1:230735210-230735232 CCTTCCACTACCTCCCAGAGCAT No data
Right 923090251 1:230735235-230735257 AAATCTCGCCCCGACTGCAGCGG No data
923090247_923090251 -2 Left 923090247 1:230735214-230735236 CCACTACCTCCCAGAGCATGGAA No data
Right 923090251 1:230735235-230735257 AAATCTCGCCCCGACTGCAGCGG No data
923090248_923090251 -8 Left 923090248 1:230735220-230735242 CCTCCCAGAGCATGGAAATCTCG No data
Right 923090251 1:230735235-230735257 AAATCTCGCCCCGACTGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923090251 Original CRISPR AAATCTCGCCCCGACTGCAG CGG Intergenic