ID: 923090348

View in Genome Browser
Species Human (GRCh38)
Location 1:230735767-230735789
Sequence AAGGAGAAGCAGTTTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923090348_923090356 5 Left 923090348 1:230735767-230735789 CCTTCCTGAAACTGCTTCTCCTT No data
Right 923090356 1:230735795-230735817 CCTCAGAGCTGTAGATTCTAGGG No data
923090348_923090357 6 Left 923090348 1:230735767-230735789 CCTTCCTGAAACTGCTTCTCCTT No data
Right 923090357 1:230735796-230735818 CTCAGAGCTGTAGATTCTAGGGG No data
923090348_923090354 4 Left 923090348 1:230735767-230735789 CCTTCCTGAAACTGCTTCTCCTT No data
Right 923090354 1:230735794-230735816 CCCTCAGAGCTGTAGATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923090348 Original CRISPR AAGGAGAAGCAGTTTCAGGA AGG (reversed) Intergenic
No off target data available for this crispr