ID: 923091586

View in Genome Browser
Species Human (GRCh38)
Location 1:230745166-230745188
Sequence CTGACTTGCCTCAACTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923091586_923091596 28 Left 923091586 1:230745166-230745188 CCTTGCAAGTTGAGGCAAGTCAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 923091596 1:230745217-230745239 GCATCTGTGGGAGTGGCAGGGGG 0: 1
1: 0
2: 3
3: 35
4: 499
923091586_923091591 16 Left 923091586 1:230745166-230745188 CCTTGCAAGTTGAGGCAAGTCAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 923091591 1:230745205-230745227 TGAAATTCAGCAGCATCTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 253
923091586_923091590 15 Left 923091586 1:230745166-230745188 CCTTGCAAGTTGAGGCAAGTCAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 923091590 1:230745204-230745226 ATGAAATTCAGCAGCATCTGTGG 0: 1
1: 0
2: 4
3: 31
4: 354
923091586_923091593 25 Left 923091586 1:230745166-230745188 CCTTGCAAGTTGAGGCAAGTCAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 923091593 1:230745214-230745236 GCAGCATCTGTGGGAGTGGCAGG 0: 1
1: 0
2: 3
3: 48
4: 365
923091586_923091592 21 Left 923091586 1:230745166-230745188 CCTTGCAAGTTGAGGCAAGTCAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 923091592 1:230745210-230745232 TTCAGCAGCATCTGTGGGAGTGG 0: 1
1: 0
2: 1
3: 40
4: 290
923091586_923091594 26 Left 923091586 1:230745166-230745188 CCTTGCAAGTTGAGGCAAGTCAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 923091594 1:230745215-230745237 CAGCATCTGTGGGAGTGGCAGGG 0: 1
1: 0
2: 3
3: 36
4: 316
923091586_923091595 27 Left 923091586 1:230745166-230745188 CCTTGCAAGTTGAGGCAAGTCAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 923091595 1:230745216-230745238 AGCATCTGTGGGAGTGGCAGGGG 0: 1
1: 1
2: 6
3: 58
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923091586 Original CRISPR CTGACTTGCCTCAACTTGCA AGG (reversed) Intergenic
902820507 1:18940339-18940361 GTGACTTGCCCAAAGTTGCACGG - Intronic
906220076 1:44071614-44071636 CTCACTTCCCTCCACTTTCATGG + Intergenic
908091698 1:60692713-60692735 CTGGCTTGTCTCAACTTCCTGGG + Intergenic
916430730 1:164725495-164725517 CTAACTTGCTTCTGCTTGCATGG + Intronic
919866449 1:201786626-201786648 CTGCCTTGCCTCACCCTGCAGGG - Intronic
923091586 1:230745166-230745188 CTGACTTGCCTCAACTTGCAAGG - Intergenic
1064493000 10:15879721-15879743 ATGACTTGCCACAACTCGAAAGG - Intergenic
1067131326 10:43568072-43568094 CTGACTTCACCCCACTTGCAGGG - Exonic
1068874680 10:61983718-61983740 TTGGCTTGCCACAACTTCCATGG - Intronic
1070456418 10:76621584-76621606 TTAACTTGCCTCTACATGCATGG - Intergenic
1074426929 10:113359550-113359572 CCGACTTGCCTCAGGTTGCTGGG - Intergenic
1076346163 10:129780229-129780251 CTGGCTTGCCTCAACCAGCATGG + Intergenic
1077158700 11:1102974-1102996 CTGAGATGCCCCTACTTGCAGGG + Intergenic
1078240806 11:9529533-9529555 CTGACTTTGCTCAAATTCCAGGG + Intergenic
1078290525 11:10006160-10006182 CTGACTTGCCTCGAGGTGGACGG - Intronic
1088544461 11:110945799-110945821 CAGACTTGCTTCCACTTGCCTGG + Intergenic
1089669175 11:120040580-120040602 CAGACTGGCCTCTACTTGCCAGG + Intergenic
1091619311 12:2074454-2074476 CTGACTTGCCGAAAGTTGAATGG + Intronic
1093292742 12:17348413-17348435 CTCATTTGCATCAAATTGCATGG - Intergenic
1094490411 12:30957333-30957355 CTGACTTGTCTCACCTGCCACGG - Intronic
1097718693 12:62996980-62997002 CTACCTTGCCTCCACTTACAGGG + Intergenic
1100198353 12:92272517-92272539 CTGACCTGCTTCTACTTGCCTGG + Intergenic
1110484104 13:76017734-76017756 CCCACTTCCCTCCACTTGCAAGG - Intergenic
1113926317 13:113943768-113943790 CTGCCTTCCCTCACGTTGCAAGG - Intergenic
1117166942 14:53044932-53044954 CTGTCTTTTCTTAACTTGCAAGG - Exonic
1118454157 14:65929861-65929883 CTGACTTCCCTTTACTTACAGGG + Intergenic
1119432847 14:74579531-74579553 CTGCCTTGCCTCAGCCTCCACGG - Intronic
1120851374 14:89175182-89175204 CTGACTTGCTTCATGTTCCATGG + Intronic
1120957193 14:90093143-90093165 CTCAGTTTCCTCATCTTGCATGG - Intronic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1125883353 15:43211345-43211367 CTGTCTAGCCTCAACATGCAAGG + Intronic
1126570355 15:50144046-50144068 CTGAATTGGCTCAGCTTCCAGGG - Intronic
1127239009 15:57090140-57090162 CTGACTAGCCTCAACCTCCCAGG - Intronic
1128539797 15:68518585-68518607 CTGACTGGACTCACCTTGGAAGG - Intergenic
1132981553 16:2740775-2740797 CTGACTTGAGTCAACCTGGAGGG + Intergenic
1136186962 16:28593953-28593975 CAGACTTGTCTCATCTTCCACGG - Intronic
1138443148 16:57047064-57047086 CTCACTTGCCTCCACTTCCCTGG - Intronic
1138827908 16:60342904-60342926 CTCACTGGCCTCAACATGCAGGG + Intergenic
1140412685 16:74750684-74750706 CTGACTTGTCTCAGGTGGCATGG + Intronic
1143495606 17:7310926-7310948 CTGACTTCCCTCATCAGGCAAGG + Intronic
1145869479 17:28261713-28261735 CTGACTTCCCACAACAAGCATGG - Intergenic
1146930985 17:36777906-36777928 CAGTCTTTCCTCAACTTTCAAGG - Intergenic
1150717947 17:67587840-67587862 TTGACTGGGCTCAACTTGCATGG + Intronic
1153504585 18:5782908-5782930 TTGTCTAGCCTCATCTTGCAGGG + Intergenic
1153512845 18:5874162-5874184 CAGACTTACCTCAACTGCCAGGG - Intergenic
1155514121 18:26606733-26606755 CTGACTTGGCTGATCTTGAATGG - Intronic
1155929393 18:31689800-31689822 CTGATTTCCCTCAACCTTCAGGG - Intergenic
1160131797 18:76231803-76231825 GTGAGCAGCCTCAACTTGCAAGG - Intergenic
1160251065 18:77203898-77203920 CTGACTTGCCTCATTTGGAAGGG + Intergenic
1162918581 19:13887297-13887319 CTGGGTCGCCTCAACTTGCTGGG + Intronic
1163236527 19:16033380-16033402 CTGACTTGGCCCAACTGACAAGG - Intergenic
929988275 2:46759642-46759664 CTGATTTGCTTCAAATTACAGGG + Exonic
930739743 2:54819070-54819092 CAGACTTGCCTGAGCTTGAATGG + Intronic
932703209 2:74004505-74004527 CTTACTTGCCTCAAGTTCCTTGG - Intronic
933192233 2:79347656-79347678 CTGACTGGCCTCAGGTCGCATGG + Intronic
935949436 2:108315470-108315492 CTGACTTGCAGCAACCTGCTTGG - Intergenic
937733098 2:125258545-125258567 CTGACTCTCCTCTACCTGCAGGG + Intergenic
945023236 2:205595050-205595072 CTGCCTTTCCTCCCCTTGCAGGG - Intronic
946302721 2:218833815-218833837 CTGACTTGCCTCCTTTTGAAGGG + Intergenic
1168842260 20:916990-917012 CTCACTTGCCCCACCTTGGAAGG - Intergenic
1172615252 20:36279255-36279277 GTGAGTTGCATCAACTTTCAGGG - Intergenic
1174725183 20:52854108-52854130 CTGGCTTGCACCATCTTGCAAGG + Intergenic
1176375244 21:6083757-6083779 CTGACTTCCCTCTTCTTACAAGG + Intergenic
1179748230 21:43454487-43454509 CTGACTTCCCTCTTCTTACAAGG - Intergenic
1183047052 22:35228736-35228758 CTTTCTTGGCTCATCTTGCATGG - Intergenic
949346635 3:3083108-3083130 GTGACTTGCCTCCAGTTGGAGGG + Intronic
950495245 3:13329903-13329925 GTGACTTGCTTAAGCTTGCATGG - Intronic
953498229 3:43407278-43407300 CAGACTTGCCCAAGCTTGCATGG + Intronic
953641178 3:44709754-44709776 CTGATTTGCTTCAAATTACAGGG - Intergenic
954951163 3:54475077-54475099 CTGACTTGACGCAATGTGCAAGG - Intronic
955157808 3:56434580-56434602 CTTACCTGCCTCAACATGGAGGG + Exonic
956131407 3:66057105-66057127 CTGACTTCCCGCAACATACAGGG + Intergenic
963519486 3:146346442-146346464 CTGACTTCCCGCAACATGTAAGG - Intergenic
964595345 3:158421120-158421142 CTAACTTGTCTCAGCTTGCCTGG - Intronic
967216900 3:187218846-187218868 CTGAACTCCCTCATCTTGCAAGG - Intronic
971716811 4:30188576-30188598 CTGACTTTCATGAATTTGCAGGG - Intergenic
973804316 4:54510786-54510808 CTGATTTGCCTTACCTTGCAAGG - Intergenic
976584473 4:86779643-86779665 CTGACTAGCCCCAAAATGCAAGG - Intronic
978693174 4:111540831-111540853 CTGACTTTTCTCAGCTTGCCAGG + Intergenic
983844405 4:172499006-172499028 CTGACTAGCCCCACCTTGCATGG - Intronic
984725080 4:183013030-183013052 CTGAATTGAATCCACTTGCAGGG + Intergenic
987669745 5:20991024-20991046 CTGACATGCCTCACCTTTCCTGG + Intergenic
993156293 5:84228807-84228829 CTGACTTACTTCAACTAGCCTGG - Intronic
997936957 5:138120813-138120835 CAGACTTTCCTCAATTTACATGG + Intronic
1003669816 6:8146586-8146608 TTTACTTGCCTTAAATTGCATGG - Intergenic
1003806230 6:9728458-9728480 CTGACTTGCTGCATCTTCCAAGG + Intronic
1006292779 6:33152934-33152956 CTGACTTCCCGCAACAGGCATGG + Intergenic
1006881508 6:37343948-37343970 CTGACATTCCTCACATTGCAAGG - Intergenic
1007267073 6:40604659-40604681 CTCTCTTGCCTCATTTTGCAGGG - Intergenic
1010073359 6:71770848-71770870 CTGGCTTTCCTCAACTTTCAGGG + Intergenic
1013572044 6:111438125-111438147 CTGCCTTGCCTCAAAGTGCTGGG + Intronic
1015180908 6:130361355-130361377 CTGACTTCCCGCAACATGAAAGG + Intronic
1018673055 6:166195330-166195352 CTGTCTTGCCTCCACATGAAGGG - Intergenic
1019220851 6:170471619-170471641 CTGACTTTCCTAATGTTGCATGG - Intergenic
1023275170 7:38511011-38511033 GTAACTTGCCCCAAGTTGCATGG - Intronic
1026473128 7:70711191-70711213 CTGTCTTCCCTCAACCTGGAGGG - Intronic
1027418696 7:77998937-77998959 CTGACTTATCTCAAATTCCATGG - Intergenic
1027511897 7:79093601-79093623 GAGTCTTGCCTCAACTTCCATGG + Intronic
1029306972 7:99626704-99626726 CTGACTTGCAGCTACTTCCAGGG - Intronic
1029373362 7:100163315-100163337 CTGACCTGCATCAGCCTGCAGGG - Intronic
1030429893 7:109431657-109431679 ATGTCTTGCCACAACTTGAATGG - Intergenic
1030455296 7:109765247-109765269 CTGACTTGCCTAAAGTTACATGG + Intergenic
1031873328 7:127110796-127110818 CTGACTTTCCCCAACATGGAGGG + Intronic
1032675343 7:134125031-134125053 ATGACTTGCCCCAAATTGCCTGG - Intergenic
1033867399 7:145708803-145708825 ATGACTTACCTAAAATTGCACGG + Intergenic
1036386413 8:8285560-8285582 CTGACTTGCTTCAAATTTCCAGG + Intergenic
1038075379 8:24067111-24067133 CAGACATGAGTCAACTTGCAAGG - Intergenic
1039842016 8:41300781-41300803 CTGGCTTCCATCAGCTTGCAGGG - Intronic
1040696602 8:50007117-50007139 CTGGTTTGCCTCAACTTGCTTGG + Intronic
1043820138 8:84853250-84853272 CTGACTTGCCTAAAGTTACAAGG - Intronic
1043927608 8:86055406-86055428 CTGACTTGCCTTAAACTGAATGG - Intronic
1045471604 8:102517658-102517680 CTTACTAGCCCCAGCTTGCAGGG - Intergenic
1047290878 8:123529481-123529503 ATGACTTACCTCAACTTCCCGGG - Intronic
1048068939 8:131001414-131001436 GTGACTTGCCTAAACTCACATGG - Intronic
1049271605 8:141699007-141699029 CTGCCCTGCCACAACCTGCACGG - Intergenic
1056318027 9:85410163-85410185 CTGACTTCCATCAGCTTTCATGG + Intergenic
1056936574 9:90919408-90919430 CTCACTTGCCTCACCTGGCCTGG + Intergenic
1185771890 X:2771129-2771151 CAGACGTGCCTCAACATGCCTGG + Intronic
1185965685 X:4599396-4599418 CCCACTTCCCTGAACTTGCATGG - Intergenic
1187355974 X:18572183-18572205 GTGGCTTGCCTAAAGTTGCATGG + Intronic
1187565356 X:20444281-20444303 CTAACATGCCTCTACTTGGATGG + Intergenic
1189630700 X:42949610-42949632 TTGACTAGCCTCAGCTTGCAGGG + Intergenic
1190936096 X:55000466-55000488 CTGATTTGCCACCCCTTGCAGGG - Exonic
1195460302 X:105116100-105116122 CCGGCTTCCCTCCACTTGCAGGG - Intronic
1198644587 X:138792347-138792369 ATGTCTTGCCCCAAATTGCATGG + Intronic