ID: 923092278

View in Genome Browser
Species Human (GRCh38)
Location 1:230749711-230749733
Sequence GGGACAATAATGCAACTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923092278 Original CRISPR GGGACAATAATGCAACTTAT GGG Intronic
903583105 1:24387145-24387167 GGGGCAAAAATGCAATTTAGCGG + Intronic
905720239 1:40193734-40193756 TGGAAAATAATGCAACATATTGG + Intronic
907001349 1:50861573-50861595 GGGACAAAAATGCTACTTATTGG + Intronic
907695788 1:56727314-56727336 GGGGAAAAAATGCAAATTATAGG - Intronic
907856287 1:58306907-58306929 GGGACATAAATCCTACTTATGGG + Intronic
910077166 1:83295282-83295304 GGGAAAATCATGCAATTTAAAGG + Intergenic
910868687 1:91811434-91811456 CCTACAATAATGCAAATTATTGG - Intronic
912851501 1:113129619-113129641 GGGACACTAATCCTACTTAGAGG - Exonic
914927916 1:151905313-151905335 GTGAGAATAATGGAATTTATTGG - Intronic
915980738 1:160418497-160418519 TGGAAAATAATGCTAATTATTGG - Intronic
920553245 1:206882776-206882798 GGGATTATAAAGCAACGTATGGG - Intergenic
923092278 1:230749711-230749733 GGGACAATAATGCAACTTATGGG + Intronic
923850131 1:237785282-237785304 GTGAGAATAATGCCACTTACAGG - Intronic
1064539053 10:16387706-16387728 GTGACAATAATATCACTTATTGG - Intergenic
1065094827 10:22270189-22270211 GGGACAAAAATGCAAGTAGTAGG - Intergenic
1065643821 10:27814118-27814140 GGGAGAAAAATGGAATTTATTGG + Intronic
1066305066 10:34132782-34132804 GGGCCAAAAAGGCAACTTTTGGG - Intronic
1067974853 10:51012677-51012699 GGCACAATAGTGCAAGTCATTGG + Intronic
1071009227 10:80918006-80918028 GGCACAATGATGCAGCATATAGG - Intergenic
1074395213 10:113092292-113092314 GGTACAAAGATGCCACTTATGGG + Intronic
1077640292 11:3875302-3875324 AGAAAAATAATTCAACTTATAGG - Intronic
1078261161 11:9710210-9710232 GGGGCAATAATTAACCTTATAGG + Intronic
1081126205 11:39325864-39325886 GCCACAAGAATGCAACTTGTAGG - Intergenic
1081783172 11:45727580-45727602 AGGAGAATAATGCAAATTTTGGG + Intergenic
1085542375 11:77284063-77284085 GACTCAATAATGCCACTTATGGG + Intronic
1087204471 11:95379291-95379313 GGAACAAAAATACTACTTATGGG - Intergenic
1088060013 11:105636334-105636356 GGGACAAAAATGAAAGTGATGGG - Intronic
1088932288 11:114364348-114364370 AAGAAAAGAATGCAACTTATTGG - Intergenic
1091009709 11:131988162-131988184 AGGACACTAATTCCACTTATGGG + Intronic
1093922029 12:24869445-24869467 GTGAGAATAATGGAACTTATTGG - Intronic
1096730578 12:53608924-53608946 GAGACTATAATGCAGGTTATGGG + Intronic
1097921241 12:65076532-65076554 GACACAATAATTCAACTTTTAGG + Intronic
1100844991 12:98649054-98649076 GAGACAATAAGACAATTTATAGG + Intronic
1106596851 13:31150247-31150269 GGGAAAATAATGAAATTCATTGG - Intronic
1109861857 13:68210263-68210285 GGGAAAATAATGCAAGATGTGGG - Intergenic
1110096139 13:71523627-71523649 GAGACAGTAATGCATCTTGTAGG - Intronic
1111244601 13:85519310-85519332 GGGACAATAATATTACCTATTGG + Intergenic
1112882741 13:104128883-104128905 GGTACAATAATGCTATATATTGG - Intergenic
1114781472 14:25542912-25542934 GAGACAATAGTGCACCATATAGG + Intergenic
1115178858 14:30598578-30598600 GAGACTATAATGCACCTGATAGG + Exonic
1115851500 14:37593148-37593170 AGGACAATAAAGCCACTTGTTGG - Intronic
1117565868 14:56992665-56992687 GTGAGAAAAATGGAACTTATTGG - Intergenic
1118395814 14:65335601-65335623 GTGAGAAGAATGGAACTTATTGG + Intergenic
1119491053 14:75033808-75033830 GGGAAAATAATAAAACTTATAGG - Intronic
1121262525 14:92576726-92576748 GGGATAATAATAAAACTCATGGG + Intronic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1124512593 15:30339866-30339888 GAGACAATAGTTCAAATTATAGG + Intergenic
1124730322 15:32190884-32190906 GAGACAATAGTTCAAATTATAGG - Intergenic
1127346794 15:58109103-58109125 GGGAAAATACTGCAGCTTCTTGG - Intronic
1131821690 15:96280376-96280398 GATCCAATAATGCAACTTCTTGG + Intergenic
1133535913 16:6702251-6702273 GGGACAAATATCCAAATTATCGG + Intronic
1133699315 16:8294371-8294393 GGGATAATAATACAACTAACAGG + Intergenic
1134213534 16:12297867-12297889 GGAACAATAATAGCACTTATGGG + Intronic
1135496763 16:22958742-22958764 GGGACATTCATGCAAGTTCTGGG + Intergenic
1140434435 16:74934367-74934389 GTGACAATTATACAATTTATGGG + Intronic
1140576849 16:76180589-76180611 GTGAAAATAATCCATCTTATCGG + Intergenic
1141746052 16:85926931-85926953 GGGGCAATAATGTTACCTATTGG + Intergenic
1147500771 17:40961348-40961370 GGGATAATCATGCAAATAATAGG - Intronic
1147560625 17:41506812-41506834 GGGACAGTCCTGCACCTTATAGG - Intergenic
1152989306 18:348847-348869 GGGAAAGTAATGCCACTGATAGG + Intronic
1157899539 18:51501234-51501256 GGGAATTTAATGCAAGTTATTGG - Intergenic
1158152420 18:54387674-54387696 GTGAGAATAATGGAATTTATCGG + Intergenic
1163885805 19:19963720-19963742 GGGACAGTATTGCAACCCATAGG - Intergenic
930353892 2:50292984-50293006 GTGACACTAATGCAACTTAAAGG + Intronic
931316722 2:61139802-61139824 GGCCCAGTAATGCAACTTCTAGG + Intergenic
931629582 2:64286819-64286841 GGGACAAAAATCTAACTAATGGG - Intergenic
933332945 2:80917976-80917998 TGGTCCATAATGCAAATTATGGG + Intergenic
933470996 2:82723119-82723141 AGGATAATAAAGCATCTTATGGG - Intergenic
933806682 2:86003336-86003358 GGGACAAAGCTGCAACATATGGG + Intergenic
939208257 2:139136509-139136531 ATGATAATATTGCAACTTATAGG - Intergenic
939432778 2:142131651-142131673 GGAACAATAAAGCAACGAATTGG + Exonic
939840364 2:147180888-147180910 GTGAGAAAAATGGAACTTATTGG + Intergenic
941249364 2:163143755-163143777 GTGAGAATAATGGAATTTATTGG - Intergenic
944131803 2:196354687-196354709 GGGACAACATTGCAAATTCTTGG + Intronic
945051822 2:205831122-205831144 GTGAGAATAATGGAATTTATTGG - Intergenic
947426910 2:229992134-229992156 GAGAAAAAAATGCAACTTATGGG - Intronic
947831681 2:233146030-233146052 GGGATAATAATAGAACTTGTGGG + Intronic
948585035 2:239014090-239014112 GGGATAGTAATACAAATTATGGG + Intergenic
1173726103 20:45299019-45299041 GGGACAATATTCAAGCTTATTGG - Intronic
1177021659 21:15867821-15867843 GGGAAAATTATAAAACTTATTGG + Intronic
1178044322 21:28676766-28676788 GTGAGAATAATGGAATTTATTGG - Intergenic
1179338291 21:40479146-40479168 AGGACAATAATAGAATTTATAGG - Intronic
949689348 3:6617270-6617292 ACCAAAATAATGCAACTTATGGG - Intergenic
950246677 3:11426665-11426687 GGGATAATAATGCAATCTAGTGG - Intronic
952561651 3:34602109-34602131 GGGATAAAAATACAAGTTATAGG + Intergenic
956598213 3:70991897-70991919 GGGACAATAACTCAAATCATAGG + Intronic
957259454 3:77881008-77881030 GGGAAAATGATCCTACTTATTGG + Intergenic
957487843 3:80886031-80886053 GAAACAATAATGAAACATATAGG + Intergenic
958889523 3:99768074-99768096 GCGACAGTAAGGCAAATTATTGG + Intronic
960641712 3:119831203-119831225 AGGAGAATAATCCATCTTATGGG + Intronic
961512833 3:127413560-127413582 GGGCCAAAAAGGCAACTTTTGGG - Intergenic
961556932 3:127702219-127702241 GGGACAACAGGGCAACTCATGGG + Intronic
962190398 3:133304467-133304489 GGCACAATAAAGAAACTTTTTGG - Intronic
963839955 3:150094998-150095020 GGGACAATGATGTACCTCATGGG + Intergenic
965584864 3:170308629-170308651 GGTTCACTAATGAAACTTATAGG + Intergenic
967480841 3:189971720-189971742 GAGATGATAATGCCACTTATTGG + Intronic
967531216 3:190550372-190550394 GGGACAATAATGTGTCTCATGGG + Intronic
969206591 4:5651869-5651891 GGGACAATGATGGAAATTTTAGG - Intronic
969979076 4:11135585-11135607 GGGAAGATAATGCAACAGATGGG - Intergenic
973341268 4:49007200-49007222 GGGACAATGATGTTAATTATCGG + Exonic
974532790 4:63131761-63131783 GAGAAAATAATACAAATTATGGG - Intergenic
978719124 4:111885521-111885543 GGGAAAATAATAAAATTTATTGG + Intergenic
979089090 4:116455100-116455122 GTAACAATTATTCAACTTATTGG - Intergenic
981743732 4:148031389-148031411 GGGATAATAATACTACCTATAGG - Intronic
982330374 4:154175745-154175767 GGGACAAAAATAATACTTATGGG - Intergenic
984064780 4:175034593-175034615 GGGAAAAAAATGCAGCTGATTGG - Intergenic
985817897 5:2140152-2140174 GGGACAATATTGCATCTTATTGG + Intergenic
987798482 5:22662125-22662147 CAGACAATAATGGAACTTTTTGG - Intronic
988699355 5:33658000-33658022 GGGATAGTAATGCACCTCATGGG - Intronic
988849358 5:35163214-35163236 GGGAGAAAAATGAAATTTATTGG - Intronic
995189194 5:109302810-109302832 GGGAAAAAAATGCAAGTTATTGG - Intergenic
995640109 5:114246285-114246307 GGGATGATTATGCATCTTATTGG + Intergenic
998639784 5:143996363-143996385 AGGACAATAAAGCCACTTAAGGG + Intergenic
998822914 5:146073048-146073070 GGGACAATAATACAACTCATGGG - Intronic
1004856323 6:19754356-19754378 GGAAAAATAATGCAAATTAGTGG + Intergenic
1005148169 6:22716476-22716498 GGGATGATAGTGCAACTTGTGGG + Intergenic
1007282403 6:40722196-40722218 ATGACAATAATGCTTCTTATAGG + Intergenic
1009432017 6:63574339-63574361 GTGATTATAATGCAACTGATAGG + Intronic
1009445880 6:63741607-63741629 GGGAAAATCAAGCTACTTATTGG - Intronic
1016686113 6:146884159-146884181 GTGAGAATAATGGAATTTATTGG - Intergenic
1020405264 7:7825808-7825830 GGGACAATTATACACGTTATAGG - Intronic
1020765997 7:12321871-12321893 AGAACAATAATGAAACTTACTGG - Intergenic
1021083631 7:16393080-16393102 GATACAATAATGCAAAATATTGG + Intronic
1022676165 7:32501272-32501294 GTGACAATAATGAAACATTTGGG + Intronic
1029045574 7:97624521-97624543 GGGACATTAATCCCACTTATAGG + Intergenic
1034219520 7:149433022-149433044 GGGCCAATAATGCAATGTTTTGG - Intronic
1041947721 8:63464803-63464825 AGGATAATAAAGCATCTTATGGG - Intergenic
1047378977 8:124338352-124338374 GGTTCAGTAATGCCACTTATAGG - Intronic
1047739433 8:127794732-127794754 GGGACAAAATTGGAACTTACTGG - Intergenic
1055293772 9:74813259-74813281 GAGACAAGAATGCAACATTTTGG + Intronic
1058142802 9:101375855-101375877 GTGAGAAAAATGGAACTTATTGG - Intronic
1060653899 9:125354999-125355021 AGGAGAAAAATGCAATTTATTGG - Intronic
1188549867 X:31351290-31351312 TGGAAAATAATATAACTTATAGG + Intronic
1188934421 X:36155773-36155795 TGTACCATAATGGAACTTATAGG + Intergenic
1189006238 X:36998606-36998628 GGGACAAAAATGTATCTCATGGG - Intergenic
1189042354 X:37555199-37555221 GGGACAAAAATGTATCTCATGGG + Intronic
1190950927 X:55141933-55141955 GGGAAAAAAATCCAACTTTTTGG - Intronic
1191906645 X:66099568-66099590 GTAACAATATTGCATCTTATAGG - Intergenic
1193956045 X:87864128-87864150 GCGACAATAATGCATCTTTCAGG - Intergenic
1196586779 X:117439221-117439243 GGGATAATAATCCAACTTCATGG - Intergenic
1197056416 X:122125587-122125609 GGGACAATAATACAAATACTAGG - Intergenic
1197551970 X:127902320-127902342 GGCATAATGATGCAACTGATGGG - Intergenic
1198958516 X:142158350-142158372 AGACCAATACTGCAACTTATTGG - Intergenic