ID: 923093916

View in Genome Browser
Species Human (GRCh38)
Location 1:230760087-230760109
Sequence CTGAGGGTCTGCGGGTCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923093916_923093926 17 Left 923093916 1:230760087-230760109 CCGTGTGACCCGCAGACCCTCAG 0: 1
1: 0
2: 1
3: 11
4: 172
Right 923093926 1:230760127-230760149 AGAGGCTTGCCCCCAGGAGATGG 0: 1
1: 0
2: 0
3: 33
4: 499
923093916_923093922 -6 Left 923093916 1:230760087-230760109 CCGTGTGACCCGCAGACCCTCAG 0: 1
1: 0
2: 1
3: 11
4: 172
Right 923093922 1:230760104-230760126 CCTCAGCCGAGGTGCACATCAGG 0: 1
1: 0
2: 0
3: 5
4: 86
923093916_923093923 -1 Left 923093916 1:230760087-230760109 CCGTGTGACCCGCAGACCCTCAG 0: 1
1: 0
2: 1
3: 11
4: 172
Right 923093923 1:230760109-230760131 GCCGAGGTGCACATCAGGAGAGG 0: 1
1: 0
2: 0
3: 11
4: 185
923093916_923093925 11 Left 923093916 1:230760087-230760109 CCGTGTGACCCGCAGACCCTCAG 0: 1
1: 0
2: 1
3: 11
4: 172
Right 923093925 1:230760121-230760143 ATCAGGAGAGGCTTGCCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923093916 Original CRISPR CTGAGGGTCTGCGGGTCACA CGG (reversed) Intronic
900183781 1:1323944-1323966 CTGAGGGTCTGGGGGTCTGCTGG + Intronic
900183802 1:1324000-1324022 CTGAGGGTCTGCTGGGCTGAGGG + Intronic
900183844 1:1324112-1324134 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900183885 1:1324208-1324230 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900354629 1:2254332-2254354 CCGTGGGTCTTCGTGTCACAGGG + Intronic
900409605 1:2506742-2506764 CTGGGGGTCTGCGGGAGTCAAGG + Intergenic
900489258 1:2938756-2938778 CTGAGGGTCTGTGGGGGTCATGG - Intergenic
900489593 1:2940560-2940582 CTGAGGGTCTGTGGGGATCACGG - Intergenic
900857668 1:5198947-5198969 CTGAGGGTCTGGGCCACACAGGG + Intergenic
900951082 1:5858607-5858629 CTGAGGGTCTGAGGGGAGCAGGG - Intergenic
902181929 1:14696087-14696109 CTGGGGGTCTCAGGTTCACATGG - Intronic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
902785764 1:18731684-18731706 CTGGGGGTCTGTGGATCAAAGGG - Intronic
904452943 1:30628154-30628176 CTCAGAGTCTGAGGGTCCCAGGG + Intergenic
905631579 1:39521851-39521873 ATGAGGGGCTGCGGCTCCCAGGG - Intronic
905666175 1:39764320-39764342 ATGAGGGGCTGCGGCTCCCAGGG + Intronic
905789097 1:40780982-40781004 CTGAGGCTCTGAGAGGCACAGGG - Intergenic
906777719 1:48544714-48544736 CTCAGGGTCTCAGGGTCTCAGGG - Intronic
907422764 1:54358286-54358308 CTGAGGGTCTGTTGCACACAAGG - Intronic
910550485 1:88468405-88468427 CTGAGTGTCTGTCTGTCACATGG - Intergenic
912568794 1:110607168-110607190 CAGAGGGGCTGCGGGGCACCCGG - Intronic
914928614 1:151909771-151909793 CTGAGGGGCTGAGGGGCCCAAGG - Exonic
916533778 1:165683398-165683420 CTGAGGCTCTGAAAGTCACAGGG + Intronic
918040142 1:180908976-180908998 CCGAGGGGCTGCCAGTCACAGGG + Intergenic
920453257 1:206076661-206076683 CTAAGGATATGCTGGTCACATGG - Intronic
921213719 1:212920492-212920514 CTGAGGGTCTGTGGCCCACGTGG + Intergenic
923093916 1:230760087-230760109 CTGAGGGTCTGCGGGTCACACGG - Intronic
1062934312 10:1374760-1374782 CTGCGTGCCTGCGGGTCAGACGG + Intronic
1063188504 10:3671225-3671247 CTGGGGGTCTGGGGGACTCAGGG + Intergenic
1063441604 10:6077652-6077674 CTGCGGCTCTCCGGGACACAGGG - Intergenic
1071888156 10:89972893-89972915 CTGAGCGTCTGTGAGACACAGGG + Intergenic
1072103353 10:92250318-92250340 CTGAGGGTGGGCGGATCACGAGG - Intronic
1072682580 10:97517525-97517547 CTGAGGTTGTGCATGTCACAGGG + Intronic
1074324945 10:112441076-112441098 CTGAGGCGGTGTGGGTCACAAGG - Intronic
1074597599 10:114881695-114881717 CTGAGGCTCTGCGGGTGATCAGG - Intronic
1083300230 11:61736206-61736228 CTGTGGGTTTGCTGGTCACTGGG + Intronic
1088718748 11:112573471-112573493 CTGAGGGTCTCTGGGCCATAGGG - Intergenic
1090093170 11:123717554-123717576 CTGATGGTCTGTGGGTCAGCTGG - Intergenic
1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG + Intergenic
1092065777 12:5588569-5588591 CTGAAGGTCAGCTGGTCTCATGG + Intronic
1096549928 12:52365279-52365301 CTGAGTGTCTGCGGCTCAAGGGG + Intronic
1098355995 12:69613087-69613109 CTGAGGGTTTGTGGGTGATAGGG + Intergenic
1100378664 12:94041799-94041821 CTGAGGGGATGCGGGTCACAGGG - Intergenic
1101828235 12:108237351-108237373 CTTAGAGTTTGAGGGTCACATGG + Intronic
1101898785 12:108775705-108775727 CTGAGTGTCTGAGGGTGGCAAGG - Intergenic
1103975909 12:124702411-124702433 CTGAGGGTGTGCAGGTCCCATGG - Intergenic
1104761504 12:131299777-131299799 CTGAGGGGCTGCGGGTGGGAAGG + Intergenic
1104818272 12:131661015-131661037 CTGAGGGGCTGCGGGTGGGAAGG - Intergenic
1106211749 13:27654984-27655006 CTCAGGGTTCACGGGTCACATGG + Intronic
1111847977 13:93535431-93535453 TTGAGGCACTGCTGGTCACATGG + Intronic
1113760132 13:112840948-112840970 CTCAGTGTCTGGGGGTCTCAGGG + Intronic
1113871828 13:113564606-113564628 GGGAGGGTCTGCGGGTCTGAGGG - Intergenic
1113872085 13:113565638-113565660 CTCAGGGTCTGAGGGTCTGAGGG - Intergenic
1113932350 13:113975045-113975067 CTGAGGTCCTGAGGGTCACAGGG + Intergenic
1114769887 14:25417015-25417037 CTCTGGGTCTGCTGGTGACACGG + Intergenic
1117452973 14:55869578-55869600 CTGTGGGTTTCCTGGTCACAGGG - Intergenic
1118276287 14:64388516-64388538 CTGAGGGTGTGCAGGTCCCCCGG + Intronic
1119745447 14:77040591-77040613 CAGAGAGGCTGCGGATCACAAGG - Intergenic
1121332529 14:93058441-93058463 TTGAGGGGGTGCGGGTCACGAGG + Intronic
1121332842 14:93059335-93059357 GGGAGGGGGTGCGGGTCACAAGG + Intronic
1121541849 14:94733733-94733755 CTGGGGGTCTGTGGGCCTCAGGG - Intergenic
1122436999 14:101707075-101707097 ATGAGGCTCTGCGGTTCACCTGG + Intergenic
1122787130 14:104168939-104168961 CTGGGGGTCTGCGGGGAACAAGG + Intronic
1128388158 15:67165161-67165183 CCGAGGGTCTGCGGTGCACTTGG + Intronic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1132694995 16:1198123-1198145 CTGAGGTTCTGGGGCTCCCAAGG + Intronic
1135720028 16:24808494-24808516 CTCAGGCTCTGTGGGCCACATGG - Intronic
1136091764 16:27925750-27925772 CCGAGGGGCTGGGGGTGACAAGG + Intronic
1139435204 16:66932878-66932900 CTGAGGGTCTGGGGGCTGCAGGG - Intronic
1142352816 16:89587656-89587678 CGCGGGGTCTGCGGGTGACATGG - Intronic
1142499440 17:324034-324056 CTGAGGGTCTGGGCCTTACAGGG - Intronic
1144523030 17:15967019-15967041 CTGAGGGTGTTCGGAGCACAGGG + Intronic
1145360008 17:22204201-22204223 ATGAGCCTCTGCTGGTCACAGGG - Exonic
1148457489 17:47818889-47818911 CTGAGGGTCTGTGGAACTCAGGG - Intronic
1152116874 17:78393442-78393464 CTGAGGACCCGTGGGTCACATGG + Intronic
1152391298 17:80005567-80005589 CTCAGGGTCTTGGGGTCTCAGGG + Intronic
1152586946 17:81193437-81193459 GTCAGGATCTGCGGGCCACAGGG - Intronic
1158877407 18:61746420-61746442 CTTAGACTCTGCGGGTCGCAGGG - Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160373077 18:78390557-78390579 CTGCGGGCCTGGGGGTGACATGG + Intergenic
1160739764 19:680378-680400 CTGCAGGTCTGCGGCTCAGACGG + Exonic
1160757188 19:763984-764006 TTGAGGGGCTGCGGGTCTGAGGG + Exonic
1161442166 19:4298138-4298160 CTGGGGGTCTGCGGGCCCCAGGG - Exonic
1161586716 19:5109666-5109688 CTGAGGGTCTGGGAGGCTCAGGG - Intronic
1162798605 19:13099125-13099147 TTAAGGGTCTGCGGGTCCCTTGG + Exonic
1163554162 19:17983152-17983174 CTGAGGCTCTGGGGGACAAAGGG + Intronic
1163667943 19:18611860-18611882 CGCAGGGTCTGCGGGTTAGAGGG - Intronic
1166083539 19:40459956-40459978 CTGAGGTTCTGAGGGGGACATGG + Intronic
1166217912 19:41348203-41348225 CTGTGGGTCGGCTGGTTACAAGG - Intronic
1166259692 19:41628582-41628604 CAGAGGGACTGAGGGTCACGGGG - Intronic
1166748566 19:45153798-45153820 CGGCGGGTCTGCGGCTCACGCGG - Intronic
1167745739 19:51350815-51350837 CTCAGGCTCTGCAGGTCATACGG + Intronic
1168721583 19:58557620-58557642 TTGAGAGTGTGGGGGTCACATGG - Intronic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926832201 2:16976034-16976056 CTGAGGTTGGGCGGATCACAAGG - Intergenic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
939340942 2:140895525-140895547 CTGAGGCTCTAGGGGCCACACGG - Intronic
944060041 2:195563068-195563090 CTTAGGGTAGGCGGGTAACAGGG + Intergenic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
946902036 2:224382165-224382187 CTGAGGGTTTGCCGGCCATATGG + Intronic
948268456 2:236656316-236656338 CAGAGGGTCTGAGGGGCCCAGGG - Intergenic
1172637288 20:36418555-36418577 CAGAGACTCTGTGGGTCACAGGG - Intronic
1173668365 20:44779140-44779162 TTGAGGGGCAGCTGGTCACATGG - Intronic
1174486901 20:50866822-50866844 CTGAGGCTCAGCGAGTCACTTGG - Intronic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175400905 20:58699342-58699364 CAGGGGGTCGGCGGGCCACATGG + Intronic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1180129865 21:45820498-45820520 CTTGGGTTCTGCGGGCCACACGG + Intronic
1181001123 22:19988219-19988241 CTGAGGCTCAGAGGGGCACATGG - Intronic
1182094837 22:27619130-27619152 CTGCTGGTCTGCAGGACACAAGG + Intergenic
1183021847 22:35033664-35033686 AGGAGGGTCTGCTGGGCACAGGG + Intergenic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1184375806 22:44111943-44111965 CTGGGAGGCTGCGGGTCAGAAGG + Intronic
1184794823 22:46726092-46726114 CTGAGTGTCTGCCAGTGACATGG + Intronic
1185056581 22:48581967-48581989 CTGTGGGTCTGCGTGGAACATGG + Intronic
1185310074 22:50149464-50149486 CTGGGGGTCTGGGTGTCACCCGG - Intronic
952023240 3:29048348-29048370 CTGAGGTGCTTTGGGTCACAGGG - Intergenic
953708026 3:45245778-45245800 CAGAGTGTCTGCTGGCCACATGG + Intergenic
953750842 3:45607284-45607306 CACAGGGTCTCGGGGTCACACGG + Intronic
961551049 3:127670930-127670952 CTGAGGGCATGCAGGCCACATGG - Intronic
962431712 3:135326325-135326347 CTGAAGGCCTGTGGGTCACCGGG - Intergenic
963277064 3:143342430-143342452 ATCAGGGTCTGCTGGTCATAAGG - Intronic
969495463 4:7523762-7523784 CTGAGTGTCTGCGGGGCGCCGGG - Intronic
969688523 4:8690394-8690416 CTGAGCGTGTGCCGGGCACAAGG + Intergenic
970552120 4:17192876-17192898 CTGAGACTCTGTGAGTCACAGGG - Intergenic
970910708 4:21271588-21271610 CTGGGGGACTGCCTGTCACAGGG + Intronic
972492220 4:39598830-39598852 ATGGGGGTGTGGGGGTCACATGG - Intronic
976214574 4:82704254-82704276 CTGTGTGTCTGAGGGCCACAGGG + Intronic
978638830 4:110844145-110844167 CTGAGCACCTGCTGGTCACAAGG - Intergenic
982600655 4:157444224-157444246 CTGAAGGACTGCAGATCACAAGG - Intergenic
985373315 4:189308733-189308755 ATGAGGGCCCGCAGGTCACACGG + Intergenic
985373447 4:189309321-189309343 ATGAGGGCCCGCAGGTCACACGG + Intergenic
985544211 5:500997-501019 CTGAGGGCCTGCGTGTCCCCAGG - Intronic
986012552 5:3729193-3729215 CTGAGGGTGTGGGGGCCCCAGGG + Intergenic
987110769 5:14684495-14684517 AGGAGGGTCTGCGGGCCACCTGG - Intronic
988259571 5:28867180-28867202 CTGGGGCTATGCGGGTTACAGGG + Intergenic
992833631 5:80619285-80619307 CTGTGTGTCTGTGTGTCACATGG + Intergenic
997259743 5:132456775-132456797 CTGAGGGTCTACAGGCCAGAGGG - Intronic
998481069 5:142463353-142463375 GTGAGGGTGTGTGGGGCACAGGG + Intergenic
999188664 5:149730968-149730990 ATAAGGGTCTGCGGGGCACGTGG + Intronic
1001385113 5:171332100-171332122 CTGAGGGCCTGAGAGGCACAGGG - Intergenic
1001455823 5:171858876-171858898 CAGAGGGTCTGTGGGTGCCAAGG + Intergenic
1002120661 5:177001703-177001725 CTGAGGGGGGGCGGATCACAAGG + Intronic
1002168830 5:177364112-177364134 CTGAGAGTATTCAGGTCACAGGG - Intronic
1002294283 5:178221490-178221512 CTGAGGCTCTATGTGTCACATGG + Intronic
1002334214 5:178466828-178466850 CTGGGGGTCAGCTGGGCACACGG + Intronic
1002829229 6:804241-804263 CTTAGGGTCTGCTGGTGAGATGG + Intergenic
1010843388 6:80675701-80675723 CTGAAGGTCTGTGGGTCAGCTGG + Intergenic
1011825025 6:91295807-91295829 CTGAGGGTCTCTGGGTCATATGG + Intergenic
1014817775 6:125953835-125953857 CAGAGGGGCTGCTGGCCACAGGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019771520 7:2886496-2886518 CTCAGGGGCTCCGGGTCACATGG + Intergenic
1021852055 7:24817958-24817980 CTGAGGATCTACAGATCACAGGG + Intronic
1023473284 7:40548974-40548996 GTGAGGGCCTCCGGGTAACAAGG - Intronic
1024001723 7:45194399-45194421 CTGAGGGCCTGAGGGTCTAAGGG - Intergenic
1026879669 7:73900585-73900607 GAGAGGGGCTGCGGGTCACAGGG - Intergenic
1027418585 7:77998157-77998179 CTGAGGGTATGCCCGCCACAGGG + Intergenic
1030100469 7:105941008-105941030 CTGAGGGTCTGTGGGAGACCTGG - Intronic
1032073440 7:128824177-128824199 CTGCAGATCTGTGGGTCACATGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035307950 7:157945355-157945377 CGGGGGGTCTTCGGGACACACGG - Intronic
1036049017 8:5174857-5174879 CTGAGGTTCTGTGGGTCACCTGG - Intergenic
1036515572 8:9440376-9440398 CTCATGGCCTGTGGGTCACATGG - Intergenic
1038746160 8:30257186-30257208 CAGATGGTCTGCAGCTCACATGG + Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1044467829 8:92526810-92526832 ATGAGGGTTTGCTGGGCACAGGG - Intergenic
1049159977 8:141090898-141090920 CTCAGGGTCTGAGGGGCCCAAGG + Intergenic
1049326080 8:142022267-142022289 CTGAGGCTTAGCAGGTCACAGGG - Intergenic
1049609342 8:143546501-143546523 CTGTGTGTCTGTGTGTCACAGGG + Intergenic
1052999679 9:34571087-34571109 GTGAGGGGCTGAGGGTCAGAAGG - Intronic
1054812786 9:69447906-69447928 CTGAGGGGCTGTGGGACCCAGGG - Intronic
1057024077 9:91722683-91722705 CTGTGGGTCTGTGTGTAACAGGG + Exonic
1060740148 9:126092475-126092497 GTGGAGGTCTGGGGGTCACAGGG + Intergenic
1061028604 9:128066627-128066649 CCGAGGGTCCGAGGGCCACAGGG + Exonic
1061230657 9:129313872-129313894 TTGGGGGTCTGATGGTCACATGG + Intergenic
1061396884 9:130348346-130348368 CTGGGGGTGTGTGGGTCCCAGGG + Intronic
1061506822 9:131036333-131036355 GTGAGTGTCTGAGTGTCACAGGG + Intronic
1203384652 Un_KI270438v1:12597-12619 CTGAGGGTCTGCCTGTTAGAAGG + Intergenic
1186963669 X:14764202-14764224 CTCAGGGTCTTAGGCTCACATGG + Intergenic
1190734808 X:53249233-53249255 CTGAGGGTCTGTGACTCAGAGGG - Intronic
1193443247 X:81568141-81568163 CTGGGGGTCTGGGGTTCAAATGG + Intergenic
1195108055 X:101619226-101619248 GTGAGGGTCTGTGGGTGACTGGG + Intergenic
1197214894 X:123858916-123858938 CTGAGGATAGGCGGGGCACAAGG + Intergenic