ID: 923096209

View in Genome Browser
Species Human (GRCh38)
Location 1:230777319-230777341
Sequence ACCAGGGCTGAGCCTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 2, 2: 3, 3: 44, 4: 394}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923096203_923096209 0 Left 923096203 1:230777296-230777318 CCTCTTGAAGGAGCAGCCCCAAC 0: 1
1: 0
2: 1
3: 16
4: 136
Right 923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG 0: 1
1: 2
2: 3
3: 44
4: 394
923096201_923096209 2 Left 923096201 1:230777294-230777316 CCCCTCTTGAAGGAGCAGCCCCA 0: 1
1: 0
2: 0
3: 19
4: 218
Right 923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG 0: 1
1: 2
2: 3
3: 44
4: 394
923096196_923096209 26 Left 923096196 1:230777270-230777292 CCATGTGAGTGATCCATTGCCCT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG 0: 1
1: 2
2: 3
3: 44
4: 394
923096200_923096209 6 Left 923096200 1:230777290-230777312 CCTGCCCCTCTTGAAGGAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 213
Right 923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG 0: 1
1: 2
2: 3
3: 44
4: 394
923096202_923096209 1 Left 923096202 1:230777295-230777317 CCCTCTTGAAGGAGCAGCCCCAA 0: 1
1: 0
2: 0
3: 18
4: 137
Right 923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG 0: 1
1: 2
2: 3
3: 44
4: 394
923096197_923096209 13 Left 923096197 1:230777283-230777305 CCATTGCCCTGCCCCTCTTGAAG 0: 1
1: 0
2: 0
3: 21
4: 281
Right 923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG 0: 1
1: 2
2: 3
3: 44
4: 394
923096199_923096209 7 Left 923096199 1:230777289-230777311 CCCTGCCCCTCTTGAAGGAGCAG 0: 1
1: 0
2: 2
3: 16
4: 211
Right 923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG 0: 1
1: 2
2: 3
3: 44
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923096209 Original CRISPR ACCAGGGCTGAGCCTGCCCA AGG Intronic
900409295 1:2505582-2505604 ACCTGTCCTGAGCCTGCCCCGGG + Intergenic
900435374 1:2628569-2628591 ACCAGGGCTGTGCCTGCGGAGGG + Intronic
900702996 1:4059446-4059468 ACCAGGGCTGTCCATGCTCAGGG + Intergenic
900829550 1:4956155-4956177 TCCATGGCTGATCCTGTCCAGGG + Intergenic
900932468 1:5745963-5745985 ACCAGGGGTCAGCAGGCCCATGG - Intergenic
901853973 1:12032251-12032273 ACCTTGGCCCAGCCTGCCCAGGG - Intergenic
902184175 1:14712694-14712716 ACCAAAGCTGAGCCTCCACAGGG + Intronic
902869318 1:19304198-19304220 ATCATGGCTCAGGCTGCCCAAGG - Exonic
902925815 1:19695070-19695092 GCCTGGGCTGAGCCTGTCCTGGG - Intronic
903127574 1:21258303-21258325 ACAGAGGCTCAGCCTGCCCAGGG - Intronic
903285788 1:22275889-22275911 ACAAAGGCTGAGCTTGCCCCGGG + Intergenic
904385188 1:30136549-30136571 TTCAGGGCTCATCCTGCCCAGGG + Intergenic
904719714 1:32498983-32499005 AGCAGGGCTGAGGCTGCTCCTGG + Intronic
905548590 1:38818464-38818486 AAGAGGGCTGGGCGTGCCCAGGG - Intergenic
906128044 1:43439570-43439592 CCCAGAGCTGAGCCTTCCTATGG + Intronic
906766793 1:48441177-48441199 AACAGGACTGAGGGTGCCCAGGG + Intronic
907037435 1:51228910-51228932 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
907241106 1:53081565-53081587 GCCAGCGCTGAGCCAGGCCAGGG - Intronic
907296499 1:53459435-53459457 ACGAAGGCTGACCCTGCCAATGG + Exonic
907306988 1:53518942-53518964 CCCAGGCCTGAGTCTTCCCAAGG + Intronic
907330420 1:53667411-53667433 ACCAGGGCAGTGCATCCCCAAGG + Intronic
911095271 1:94049752-94049774 ACCAGGGTTGAGCCTGGTGATGG + Intronic
911299081 1:96151100-96151122 AACAGGACTGAGGATGCCCAGGG + Intergenic
911885446 1:103291827-103291849 ACGAGGGCAGAGCCTCCCAAAGG + Intergenic
913470412 1:119180555-119180577 AGCAGGACTGAGGGTGCCCAGGG - Intergenic
915580314 1:156809311-156809333 CCCAGGGCTGCCCCGGCCCATGG + Exonic
916053383 1:161051396-161051418 GCCACGGGTGAGCCTGGCCAAGG + Exonic
916126443 1:161575637-161575659 CCCAGAGATGAGCCTGCCCAGGG + Intergenic
916136362 1:161657477-161657499 CCCAGAGATGAGCCTGCCCAGGG + Intronic
916991561 1:170250733-170250755 ACCAGGTCCCATCCTGCCCAAGG - Intergenic
917279993 1:173371048-173371070 AACAGGACTGAGGGTGCCCAGGG + Intergenic
917531762 1:175842210-175842232 GACAGGACTGAGCCTGCCCCTGG - Intergenic
920036009 1:203065994-203066016 ACAAGGGCTTAGCCAGCCCTTGG - Intronic
920103530 1:203533885-203533907 TCCAGGGCTGAGTCGGCTCAGGG + Intergenic
920307498 1:205028521-205028543 ACCAGGGCTGATTCTTCACAGGG - Intergenic
920425162 1:205869199-205869221 AGCAGGACTGAGGGTGCCCAGGG - Intergenic
921051353 1:211514182-211514204 ATCAGGGCTGAGGGAGCCCAAGG - Intergenic
921092697 1:211858436-211858458 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG + Intronic
1062795278 10:340748-340770 ACGAGGGCTGAGCGTTCCCTGGG - Intronic
1062860032 10:803712-803734 AGCAGGGCTGAGCCTGCAGAGGG - Intergenic
1063555575 10:7075940-7075962 AGCTGGGCTCAGCCTGCACATGG + Intergenic
1064603451 10:17015655-17015677 AACAGGACTGAGGGTGCCCAGGG - Intronic
1065589595 10:27251612-27251634 ACCAGGGCTCAGGCGGCCCCCGG + Intergenic
1065925973 10:30434111-30434133 ACGGCGTCTGAGCCTGCCCAGGG - Exonic
1067031513 10:42880920-42880942 CCCTGGGCTGAGCCAGCCCAAGG + Intergenic
1068404838 10:56575034-56575056 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1069137227 10:64781629-64781651 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1069789070 10:71007811-71007833 ACCACGGCTCAGCCAGCCCAGGG + Intergenic
1070128687 10:73641678-73641700 GCCAGGGATCAGTCTGCCCAGGG + Exonic
1070820433 10:79350978-79351000 CCCAGGACAGAGTCTGCCCAAGG - Intronic
1071370398 10:84945386-84945408 ACCATGACTGGGCCTGGCCATGG - Intergenic
1072436579 10:95419581-95419603 ATCAGGCATGAGCCTTCCCAGGG + Intronic
1073330779 10:102668776-102668798 ACCAGGGCCCAGCCTGCTCCCGG - Intergenic
1073485763 10:103818231-103818253 ACCAGGGCTGAGGCAGCCCAGGG - Intronic
1075664097 10:124218588-124218610 AGCAAGGCTGAGCCTGCCCCTGG - Intergenic
1076474353 10:130742149-130742171 ACCAGAGCAGGGCCTGCCCCAGG - Intergenic
1076498304 10:130914014-130914036 CCCTGGGCTGGGCCTCCCCAGGG - Intergenic
1077051172 11:567790-567812 ACCACACCTGTGCCTGCCCAGGG + Intergenic
1077130504 11:969877-969899 AGCTGGGCTGCACCTGCCCAGGG + Intronic
1077370749 11:2180536-2180558 ACCTGGGCTGGGCCAGCCCGGGG - Intergenic
1078682043 11:13486371-13486393 TCCAGGGGTGAGCCTGCCTGAGG - Intergenic
1079098430 11:17526222-17526244 ACCAGGGGTGTGACTGTCCATGG - Intronic
1079731096 11:23938399-23938421 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1079933682 11:26593576-26593598 AGCAGGACTGAGGGTGCCCAGGG - Intronic
1080640539 11:34155876-34155898 ACCTGGGCATGGCCTGCCCAAGG - Intronic
1083322363 11:61855492-61855514 GCCAGGGCTGAGGCCGGCCATGG - Intronic
1084157288 11:67320957-67320979 TCCAGGGCTGAACCTGCCCTAGG + Intronic
1084308236 11:68300366-68300388 AACAGGGATGGCCCTGCCCAGGG - Intergenic
1084752857 11:71215395-71215417 ACCAGGGCAGAACCTGCTGAAGG - Intronic
1085601718 11:77861515-77861537 AGCAGGACTGAGGGTGCCCAGGG - Intronic
1090361720 11:126177355-126177377 TCCAGGGCTGATTCTGCTCAAGG - Intergenic
1090402509 11:126458142-126458164 CCCAGGGCCCAGCCTGTCCATGG - Intronic
1091122111 11:133065224-133065246 TCCAGGGCTGATCCTGCCCCCGG - Intronic
1091205940 11:133821156-133821178 AGCAGGGGTGCTCCTGCCCAGGG - Intergenic
1091249337 11:134129086-134129108 ACCAGGGATGTGCCTGCACAGGG - Intronic
1091319059 11:134636906-134636928 GCAAGGGCCCAGCCTGCCCAGGG - Intergenic
1091447429 12:551979-552001 GCCAGGGTTAAGCCTGCCCCTGG - Intronic
1092022770 12:5216036-5216058 ACCTGTGATTAGCCTGCCCAGGG + Intergenic
1092060846 12:5549047-5549069 ACCAGGGAAGGGCATGCCCAGGG + Intronic
1093345366 12:18034459-18034481 AACAGGACTGAGGGTGCCCAGGG + Intergenic
1093348613 12:18070116-18070138 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
1095139024 12:38639966-38639988 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
1096352025 12:50908457-50908479 AGCAGGACTGAGGGTGCCCAGGG - Intergenic
1097377211 12:58855530-58855552 AGCAGGACTGAGGGTGCCCAGGG - Intergenic
1101904116 12:108812564-108812586 GGCAGGGATGAGACTGCCCATGG + Intronic
1102019744 12:109673997-109674019 AGCAGGGCCCAGCCTGGCCAGGG - Intergenic
1102485169 12:113250574-113250596 CCCAGGGTTGTCCCTGCCCAAGG - Intronic
1103506039 12:121442873-121442895 CTCAGGGCTGCGCCCGCCCAAGG + Intronic
1104358714 12:128112141-128112163 CCCAGGGCAGTGCCTGCCCCAGG + Intergenic
1104721285 12:131046392-131046414 ACCAGGGAGGACCCTGACCAGGG - Intronic
1104721351 12:131046618-131046640 ACCAGGGAGGACACTGCCCAGGG - Intronic
1104721372 12:131046686-131046708 ACCAGGGAGGACACTGCCCAGGG - Intronic
1104721389 12:131046738-131046760 ACCAGGGAGGACACTGCCCAGGG - Intronic
1104721407 12:131046804-131046826 ACCAGGGAGGACACTGCCCAGGG - Intronic
1104898483 12:132175695-132175717 CCCAGAGCTGAGCCTGCTGAGGG + Intergenic
1106342888 13:28847953-28847975 AGGAGGGCTGAGCCTGGCCAAGG - Intronic
1111806233 13:93042960-93042982 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
1114384362 14:22240467-22240489 AGCAGGACTGAGGATGCCCAGGG + Intergenic
1116866589 14:50036484-50036506 ACCAGAGCTAGGCCTGCCCTGGG - Intergenic
1117722208 14:58638569-58638591 AGCACGGCTGTTCCTGCCCAGGG + Intronic
1118589803 14:67392837-67392859 ACCAGGGAGGAGCCTGGCCAAGG + Exonic
1119468149 14:74875988-74876010 ACCATGGCTCTGTCTGCCCAGGG - Intergenic
1119851009 14:77866811-77866833 TCCAGGGCTGAGCATGCCCTGGG + Intronic
1120947627 14:90012860-90012882 ACAGGGGCAGAGCCTGTCCAAGG + Intronic
1121078431 14:91088570-91088592 GCCAGGGCAGAGCTTGTCCAAGG + Intronic
1121458088 14:94051946-94051968 ACCAGTGCTGTGACTGCACATGG + Intronic
1121795116 14:96728196-96728218 AGCTGGGCTGGGTCTGCCCAGGG + Intergenic
1122051887 14:99066403-99066425 ACCCGGGGTGAGGCCGCCCAGGG - Intergenic
1122276065 14:100591380-100591402 AGCAGGGCCGAGCCTGGCCCAGG - Intergenic
1122825633 14:104369109-104369131 CCCAGGGCGGAGCCTGCCTGAGG + Intergenic
1123117763 14:105902326-105902348 ATCAGGGCTGGGCCTGCCGGGGG + Intergenic
1124575412 15:30903732-30903754 CCCAGGGCTCAGCCTGCCTTGGG + Intergenic
1125506627 15:40271297-40271319 TCCAGGGCTGGGCCTGAGCAGGG + Intronic
1125885510 15:43226648-43226670 GCCATGCCTGAGCCTCCCCAAGG - Intergenic
1126071955 15:44873246-44873268 AACAGGACTGAGGATGCCCAAGG - Intergenic
1127658574 15:61078723-61078745 ACCAGGGCACAGCCTACACAGGG + Intronic
1129365112 15:75049346-75049368 ACCTGCTCTGAGCCTGCCCAGGG + Exonic
1129678426 15:77644629-77644651 ACCCGGGCTCAGCCTGCCCCTGG - Intronic
1130147088 15:81282587-81282609 ACCGGGACTGAGCTTTCCCAGGG - Intronic
1130209783 15:81912481-81912503 CCCAGGGCTGACCCAGCCCAGGG + Intergenic
1131411331 15:92210470-92210492 AACAGGACTGAGGGTGCCCAAGG + Intergenic
1131608382 15:93934006-93934028 ATCAGTGCAGAGCCTGCCCATGG - Intergenic
1131963415 15:97812064-97812086 AACAGGGTTGGGCCTGCACAAGG - Intergenic
1132238153 15:100237375-100237397 GGCAGGGCTGAGGCTTCCCAGGG - Intronic
1132666202 16:1082370-1082392 TTCAGGGCTCAGCCAGCCCAGGG - Intergenic
1132849952 16:2020447-2020469 GCCAGGGTCGAGCCTGCCCAGGG - Intronic
1132896985 16:2233831-2233853 GCCAGGGCACAGCCTGCCCCGGG + Intronic
1133056834 16:3149633-3149655 TCCGGGGCTCAGCCTGCCCCAGG - Intronic
1133232967 16:4374965-4374987 ACCAGGGCTGGGCCCTCACACGG - Intronic
1133408760 16:5550444-5550466 AAGAAGGCTGAGGCTGCCCAGGG + Intergenic
1133737954 16:8629996-8630018 ACCAGGGCTTTGCCTCCCCCTGG + Intronic
1133807769 16:9138508-9138530 GCTAGGACTGAGCCTGCCCATGG - Intergenic
1134451762 16:14368179-14368201 CCCAGAGATGGGCCTGCCCAGGG + Intergenic
1135224776 16:20646386-20646408 AGCAGGACTGAGGGTGCCCAGGG + Intronic
1135293154 16:21257416-21257438 ACAAGGCTTGAGCCTGGCCAGGG + Intronic
1136451884 16:30358293-30358315 GCCAGTGCTGGGCCTGCCCCAGG - Exonic
1136482763 16:30552922-30552944 AGCAGGGCAGGGGCTGCCCATGG + Intronic
1136491325 16:30610132-30610154 ACCAGGGCTGAGCGTGGCCGGGG + Exonic
1138204306 16:55113743-55113765 CCCAGGGCTGAGCCCAGCCAGGG - Intergenic
1141650508 16:85390404-85390426 CCCAGGGCTGTGCCTGGCCGGGG + Intergenic
1142421255 16:89972068-89972090 AGTGGGGCTGGGCCTGCCCATGG - Exonic
1142603681 17:1070137-1070159 CCGAGGGCAGAGCCTGCACACGG + Intronic
1143097785 17:4487730-4487752 ACCAGGCCTGGGCCTGGGCACGG - Intronic
1143137451 17:4719797-4719819 TCCAGGGCTGCTCCTGCCCGAGG - Intronic
1143296384 17:5874878-5874900 CCCAGGGCTGACCCTGGCCTCGG - Intronic
1143560261 17:7689512-7689534 GCTAGGGCTGAGCCTGCCTCTGG - Intronic
1143651047 17:8264520-8264542 CCCAGGGCTGAGCGTGCACCAGG + Exonic
1144954226 17:19011117-19011139 ACCAGGACGGAGGCTCCCCAAGG - Intronic
1146278791 17:31531773-31531795 CCAAGGGCAGACCCTGCCCAAGG + Exonic
1146288823 17:31593847-31593869 TCCAGGGCCCAGCCTGGCCAAGG - Intergenic
1146377281 17:32303194-32303216 ACCAAGGCAGAGCCGCCCCAGGG - Intronic
1146485010 17:33235670-33235692 GCCAAGGCTGGGCCTGTCCAGGG - Intronic
1148092435 17:45030680-45030702 AGCAGGGCTGGGCCTGCACCTGG - Intronic
1148361682 17:47017351-47017373 ACCAGGGCTCAGGCGGCCCCAGG - Intronic
1148576092 17:48712345-48712367 GCCAGGGCAGGGCCAGCCCACGG + Intergenic
1150405461 17:64897077-64897099 ACCAGGGCTCAGGCGGCCCCAGG + Exonic
1150489397 17:65563896-65563918 ACCAGCTCTGAGCTGGCCCAGGG + Intronic
1150998077 17:70341911-70341933 ACCAGGGCATTGCCTGACCAAGG - Intergenic
1151390211 17:73781885-73781907 ACCAGGACTGAGCCAGGGCAGGG - Intergenic
1151652465 17:75478515-75478537 TCCAGAGCTGGGCCTGCTCAGGG + Intronic
1151666793 17:75549772-75549794 GCCAGGGAGGACCCTGCCCAAGG - Intronic
1152079088 17:78175422-78175444 ACCAGGGCTCAGCCACCACAGGG - Intronic
1152099725 17:78294057-78294079 ACATGGCCTGGGCCTGCCCAAGG + Intergenic
1152214729 17:79025357-79025379 AGCAGGGATGAGTCGGCCCAAGG - Intronic
1152271081 17:79325232-79325254 TCCAGGGATGAGCCCACCCAGGG - Intronic
1152393146 17:80014834-80014856 CCCAGTGCTGAGCCTACCTATGG - Intronic
1154217921 18:12429056-12429078 CCCAGCGCTGAGGCTGCCCCAGG - Intronic
1155231471 18:23779028-23779050 CCCAGGGCTGCCCCTGCCCCAGG - Intronic
1155540349 18:26863271-26863293 CCGGGAGCTGAGCCTGCCCAAGG + Intronic
1159881545 18:73862880-73862902 CCCAGGGCTGATTCTGCACAAGG + Intergenic
1160699559 19:499206-499228 ACCAGGCGTGATCCTGCCCCGGG + Intronic
1160720756 19:596002-596024 CCCAGGGGAGGGCCTGCCCAGGG - Intronic
1160835160 19:1121558-1121580 ACCAGGGCTGAGCCTGGCCAAGG + Intronic
1161161677 19:2765161-2765183 ACCAGCTCAGGGCCTGCCCAGGG - Intronic
1161509296 19:4661802-4661824 TCCGGGGCTGAGCATGCCCCTGG + Intronic
1162476915 19:10905760-10905782 CCGAGGGCTCAGGCTGCCCAAGG - Intronic
1162495984 19:11023686-11023708 TCCAGGGCTGGGCGTGCTCAGGG + Intronic
1163116886 19:15194394-15194416 GGCAGGGCTGAGCCTCTCCATGG - Intronic
1163302602 19:16457410-16457432 TCCATGGCTGAGCCTGTCCAGGG + Intronic
1164247844 19:23449191-23449213 ACCACAGCTCAGCCTGCACATGG + Intergenic
1164929578 19:32165256-32165278 GACAGGGCAGAGGCTGCCCAGGG + Intergenic
1165897884 19:39154469-39154491 TCCAGGGCTGAGCTGGGCCAGGG + Intronic
1166072675 19:40396017-40396039 ACCAGAGGTGAAGCTGCCCAGGG - Exonic
1166109465 19:40613536-40613558 ACCCGGGCTGATCCTGGCCCCGG + Intronic
1166752758 19:45172512-45172534 ACCAGGGCTGCTCCTTCCCTGGG - Intronic
1166936909 19:46339593-46339615 GCCTGGGCTGAGCCTGCCCTTGG - Exonic
1167301412 19:48680141-48680163 ACACGGGCTGAGTATGCCCAGGG - Intergenic
1167376947 19:49117524-49117546 ACAAGGCCTGAGCTGGCCCAGGG + Intronic
1168078214 19:53991890-53991912 ACCAGGACTGAGTCCCCCCAGGG - Intergenic
925204409 2:1994239-1994261 ACCAGGGCTGAGCCTGGTGAGGG - Intronic
925918333 2:8623094-8623116 TCCTGGGCTGAGCTTGCCCTTGG + Intergenic
925949786 2:8899536-8899558 AACAGGACTGAGGGTGCCCAGGG - Intronic
926355100 2:12034311-12034333 ACCAGGGCCCAGCCTGCCGAAGG + Intergenic
927135460 2:20093390-20093412 ACCTGGGCTGAGTGTGCACATGG - Intergenic
927600211 2:24434386-24434408 ACCTAGGCTGAGCCCTCCCAGGG + Intergenic
928024534 2:27728818-27728840 GCCAGGCCTGTACCTGCCCAGGG + Intergenic
928204557 2:29274717-29274739 AAGAGGGCTGGGCCTGGCCAAGG - Intronic
929015267 2:37487360-37487382 CCCAGCGCTGAGGCAGCCCAAGG - Intergenic
929330491 2:40675323-40675345 AACAGGACTGAGGGTGCCCAGGG + Intergenic
930281803 2:49378253-49378275 ACAAAGGCTGAACCTTCCCAAGG + Intergenic
930752758 2:54948634-54948656 AGGAGGGCTGACCCTGACCACGG + Intronic
932491729 2:72127092-72127114 ACCAGGGCTGAGCGGGCACAGGG + Intergenic
933778848 2:85787741-85787763 TCCATGGCAGGGCCTGCCCATGG - Exonic
933954680 2:87355212-87355234 ACCAGGGCTGGGCCAGGGCATGG - Intergenic
934525317 2:95048250-95048272 TCCAAGGCTGAGCCTGCCCAGGG + Intronic
935109405 2:100078183-100078205 ACCTGGGCTGAGCCTGTGAACGG - Intronic
935351323 2:102154020-102154042 AACAGGGCTGAGTCACCCCAGGG + Intronic
935658377 2:105444029-105444051 AGCAGGGAAAAGCCTGCCCATGG - Intergenic
935748736 2:106212104-106212126 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
936144164 2:109968010-109968032 ACTAAAGCTGAGCCTCCCCATGG + Intergenic
936180846 2:110265971-110265993 ACTAAAGCTGAGCCTCCCCATGG + Intergenic
936200524 2:110403459-110403481 ACTAAAGCTGAGCCTCCCCATGG - Intronic
936802185 2:116283140-116283162 AACAGGACTGAGGATGCCCAGGG + Intergenic
937224169 2:120358674-120358696 GCCAGGGCTGAGCCTCTCCCTGG - Intergenic
937289912 2:120775992-120776014 TCCTGGGCTTAGCCTGCCCAGGG + Intronic
938380161 2:130832042-130832064 TCCAGGGTGGAGCCTGGCCACGG + Intergenic
940733018 2:157416053-157416075 ACAAGGGCTGGGCCTGGCCCAGG + Exonic
942816548 2:180059791-180059813 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
946449148 2:219764703-219764725 ATCAGGCCTGAGGCTGCCCAAGG + Intergenic
947469889 2:230391717-230391739 ACCAGGCCTGAGTCTGCAGATGG - Intronic
948064583 2:235067625-235067647 CCCAGGCCTTAGCCTGGCCAGGG - Intergenic
948188070 2:236036738-236036760 ACCAAGGCTGGGGCTGCTCAGGG + Intronic
948395737 2:237643616-237643638 CCCAGGGGAGAGCCTGGCCAGGG + Intronic
948981559 2:241497298-241497320 ACCAGGGCGGCACCTGCCCGGGG + Intronic
949017996 2:241724386-241724408 CCCAGGCCCAAGCCTGCCCAGGG - Intronic
1170066138 20:12312592-12312614 AACAGGGCTGAGTGTTCCCATGG - Intergenic
1170126075 20:12965608-12965630 AGCCTGGCTGAGCCTGCTCATGG - Intergenic
1170554073 20:17501802-17501824 ACCAGGGGTGGGCCTGACCTAGG + Intronic
1170841576 20:19928579-19928601 CCCAGGGCTGGGCCTGGGCAAGG - Intronic
1171461557 20:25300833-25300855 ACCAGCACTGAGCCTGGCCGTGG - Intronic
1171751999 20:29060791-29060813 CCCAGGGCTGCCCGTGCCCATGG - Intergenic
1171790333 20:29517072-29517094 CCCAGGGCTGCCCGTGCCCATGG + Intergenic
1171857385 20:30359773-30359795 CCCAGGGCTGCCCGTGCCCATGG - Intergenic
1172011511 20:31848623-31848645 ACTAGGGCTGTGACTTCCCATGG - Intronic
1172630549 20:36375516-36375538 ATCAGAGCTGCCCCTGCCCAGGG + Intronic
1172763278 20:37336742-37336764 ACCAGGGCTGAACAAACCCAGGG - Intergenic
1172972926 20:38886583-38886605 ACCAAGGCCCAACCTGCCCACGG - Intronic
1173003796 20:39124341-39124363 TGCAGGGCTAATCCTGCCCATGG - Intergenic
1173132512 20:40408092-40408114 CCCAGGGCTCAGCATTCCCAGGG - Intergenic
1173345833 20:42199185-42199207 ACTAGGGCTGAGCTGGACCACGG + Intronic
1175759866 20:61554643-61554665 ACCAGTGCTGAGCCTGCAGTGGG + Intronic
1176082526 20:63281184-63281206 ACCAAGGCAGAGGCTGCCCCAGG - Intronic
1176167831 20:63683295-63683317 AGCAGGGCTGAGTCTGCCTCAGG - Intronic
1176663684 21:9664130-9664152 ACAAGGCCTGAGCCTCCCCGAGG - Intergenic
1177896312 21:26858827-26858849 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
1179259080 21:39742505-39742527 AGCAGGGCTGAGGGTGCCCAGGG - Intergenic
1179376028 21:40850435-40850457 AGCAGGACTGAGGCTTCCCACGG - Intergenic
1179801318 21:43812733-43812755 GGCATGGCTGGGCCTGCCCAGGG + Intergenic
1180184774 21:46134133-46134155 ACCAAGGCTCAGCCTGCTCTAGG + Intergenic
1180391036 22:12282193-12282215 CCCAGGGCTGCCCGTGCCCATGG + Intergenic
1180408706 22:12582564-12582586 CCCAGGGCTGCCCGTGCCCATGG - Intergenic
1180701174 22:17782145-17782167 CCCAGGGCTGGCCCAGCCCAGGG + Intergenic
1180711185 22:17840844-17840866 ACCAAGGCAGAGGCTGCCCCCGG + Intronic
1180840115 22:18955206-18955228 ACCAGGTCTGAGCATCCTCAGGG + Intergenic
1180899606 22:19360887-19360909 ACCAAGCCTGAGGCTGCCCAGGG + Intronic
1181166990 22:20989159-20989181 ACCAGGGCTGGGCCTGAGCCTGG - Intronic
1181469790 22:23131012-23131034 GCCATGGCTGTTCCTGCCCAGGG - Intronic
1181879762 22:25968839-25968861 ACCAGCTCTGGGCTTGCCCAGGG - Intronic
1182427535 22:30282847-30282869 CCCAGGGAGGGGCCTGCCCACGG - Intergenic
1183206490 22:36423016-36423038 CCCAGGGGTGGGCCTGCACATGG + Intergenic
1183233187 22:36595874-36595896 GCCAGAGCTGTGCCAGCCCACGG - Intronic
1183237318 22:36629321-36629343 ACCAGCTCACAGCCTGCCCAGGG - Intronic
1184383626 22:44161858-44161880 ACCAGGGCTGGGCCTGAGGATGG - Intronic
1184418371 22:44364893-44364915 TCCAGGGCTGGGCCTGCCCAGGG - Intergenic
1184454201 22:44599787-44599809 TCCAGGGCTTGGCCTGCCCTTGG + Intergenic
1184496896 22:44847165-44847187 AACAGGCCTGAGCCTGCCCTTGG - Intronic
1185014370 22:48334592-48334614 TCCAGCTCTGAGCCTGCCCAGGG + Intergenic
1185070703 22:48654253-48654275 ACCTGGGCTGGGCCTGACCCTGG + Intronic
1185108079 22:48885514-48885536 ACCACGGCTGGGCCTGACCCTGG + Intergenic
1185277977 22:49957926-49957948 CCATGGGCTGGGCCTGCCCATGG + Intergenic
1185417039 22:50716020-50716042 GACAGGGATGAGACTGCCCATGG - Intergenic
1185417065 22:50716102-50716124 GACAGGGATGAGGCTGCCCATGG - Intergenic
1185417091 22:50716184-50716206 GACAGGGATGAGGCTGCCCATGG - Intergenic
950495664 3:13332933-13332955 GCCAGGACTGAGCCTGGGCAAGG + Intronic
950749889 3:15120256-15120278 AACCAGGCTGAGCCTGCCCAGGG + Intergenic
951837922 3:27003054-27003076 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
952554942 3:34521142-34521164 AACAGGACTGAGAGTGCCCAGGG - Intergenic
954587088 3:51745498-51745520 AACAGGACTGAGGGTGCCCAGGG + Intergenic
954708848 3:52495181-52495203 AGCAGGGCTCAGGCCGCCCATGG + Intergenic
961404640 3:126669333-126669355 GCCAGGACTGAGCCTGGGCAAGG - Intergenic
962495498 3:135935654-135935676 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
962979085 3:140471576-140471598 AGCAGGGCTGAGTTTCCCCAGGG - Intronic
964953479 3:162325120-162325142 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
965054743 3:163698155-163698177 AGCAGGACTGAGGGTGCCCAGGG - Intergenic
965679009 3:171231121-171231143 CCTAGGGCTGAGCCAGCCCATGG + Intronic
965696779 3:171416704-171416726 AGCAGGGCTTAGCCTCCACAGGG + Intronic
966167433 3:177036226-177036248 ACCAGGCCTGGCCATGCCCAAGG + Intronic
966521873 3:180882170-180882192 GCCAGGGCCCAGCCAGCCCAGGG - Intronic
966861750 3:184234416-184234438 AGCAGGTCAGAGCCGGCCCACGG - Intronic
967392677 3:188972601-188972623 ACCAGAGCTGGGCCTGAGCATGG + Intronic
968458925 4:714069-714091 ATCAGGGCAGAGCCTTCCGAGGG - Intronic
968491459 4:892630-892652 GTCAGGGCTGGGCCTGGCCAGGG - Intronic
968503499 4:961623-961645 ACGAGGGCTGAGCCTGCCCATGG + Intronic
968570012 4:1334337-1334359 AGCAGGTCTGGGACTGCCCAGGG - Intronic
968628575 4:1638744-1638766 ACCAGCTCTGAGCCTGGCCTGGG - Intronic
968760832 4:2442185-2442207 ACCAGTGCTGAGTCTGTCCCAGG + Intronic
968788195 4:2640218-2640240 CCCAGGTCTGAGGGTGCCCAAGG + Intronic
973640938 4:52902018-52902040 TGCAGTGCTGAGGCTGCCCAAGG + Intronic
975761632 4:77625769-77625791 ACAAGTGCTGGGCCTGCCAAGGG + Intergenic
976189897 4:82477774-82477796 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
978747270 4:112208621-112208643 AACAGGACTGAGAGTGCCCAGGG + Intergenic
980290799 4:130846039-130846061 AACAGGACTGAGGGTGCCCAGGG - Intergenic
981000819 4:139827043-139827065 AGCAGGGCTGTGAGTGCCCAAGG + Intronic
981550297 4:145936647-145936669 ACCGCGGCGGTGCCTGCCCAGGG - Intronic
982284928 4:153724863-153724885 ACCAGGTGTGATCCTGCCCCAGG + Intronic
983147318 4:164233016-164233038 AACAGAGCTGAGCCTGCAGATGG - Intronic
984814365 4:183822937-183822959 TCCACGGCTGAGCCTGCACATGG + Intergenic
984939699 4:184920230-184920252 AACAGGACTGAGGGTGCCCAGGG - Intergenic
985547383 5:516505-516527 ACCAAGTCAGGGCCTGCCCAGGG + Intronic
985666504 5:1183990-1184012 GCCCTGGCTGGGCCTGCCCATGG - Intergenic
985758967 5:1734987-1735009 TGCAGGGCTGAGCCTCCCCCGGG - Intergenic
986549270 5:8934692-8934714 TCCAGGGCTCAGCCAGGCCAGGG - Intergenic
986859190 5:11905457-11905479 AGCAGGGCACAGCCTGCCCAGGG + Intergenic
989950602 5:50293114-50293136 GCCATGCCTGAGCCTCCCCAAGG + Intergenic
989964271 5:50450414-50450436 AACAGGACTGAGGGTGCCCAGGG - Intergenic
995465703 5:112447806-112447828 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
997736556 5:136216600-136216622 AGCAGGGCAGAGCCAGGCCAAGG - Intronic
998111554 5:139506499-139506521 AACAGGACTGAGGGTGCCCAGGG + Intergenic
998878164 5:146620833-146620855 ACCTGGGCAGAGGCTCCCCAGGG - Intronic
998891214 5:146747975-146747997 TCCAGGGCTGAACCTGCCTCTGG + Intronic
1000662799 5:163956667-163956689 ACCAGGGATGTGCATGCACAGGG + Intergenic
1001541921 5:172545571-172545593 ACCAGGCTTGAGCCTGCCCGTGG + Intergenic
1002327953 5:178421954-178421976 GGCGGGGCTGAGGCTGCCCAGGG + Intronic
1002400652 5:178990060-178990082 GCCAGGGCTCAGCCTTTCCAGGG + Intronic
1002576606 5:180177486-180177508 AGCAGGGCTGAGCCTTGGCAGGG - Intronic
1003131863 6:3401771-3401793 ACCAGAGCTGAGCTCACCCAGGG - Intronic
1003271629 6:4612972-4612994 ACAAGGGCTGTGCCTGCACTTGG + Intergenic
1003895011 6:10599156-10599178 ACCAGAGCTCATCCTGCACAAGG + Intronic
1004812332 6:19274397-19274419 AACAGGACTGAGGGTGCCCAGGG + Intergenic
1005818533 6:29577447-29577469 AGCAGGGCGGAGCTGGCCCATGG + Intronic
1006193710 6:32224254-32224276 AGCAGGGCTGGGACTGCCCAGGG - Intergenic
1006365186 6:33611055-33611077 TCCAGGGCTGTGCCTTCCGAGGG - Intergenic
1008064530 6:47033200-47033222 ACCATGGCCAAGCCTTCCCACGG - Intronic
1009320406 6:62281084-62281106 ACCAGGGCTAATCAAGCCCATGG + Intronic
1010075040 6:71788736-71788758 AACAGGACTGAGGGTGCCCAGGG + Intergenic
1010269913 6:73906974-73906996 AACAGGACTGAGGGTGCCCAGGG + Intergenic
1011076828 6:83447150-83447172 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
1011539802 6:88417398-88417420 AGCAGGACTGAGGGTGCCCAGGG - Intergenic
1012132855 6:95518986-95519008 GGCAGGGCTGGGCCAGCCCAGGG - Intergenic
1012441462 6:99265631-99265653 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1013907761 6:115237968-115237990 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1014610073 6:123532472-123532494 AACAGGCCTGAGATTGCCCAGGG + Intronic
1014813133 6:125907297-125907319 ACCTCCGCTGAGGCTGCCCAAGG + Intronic
1016300533 6:142625527-142625549 ACCATGCCTGGGCCTGCCCATGG + Intergenic
1018732035 6:166658614-166658636 ACCCTGGCAGAGCCAGCCCAGGG + Intronic
1018759242 6:166876572-166876594 ACCAGGGCTGAGCTGGCAGAAGG + Intronic
1019038530 6:169083339-169083361 ACCTGGGATGAGCCTCCCCTGGG + Intergenic
1019290065 7:245981-246003 ACCGGGGCTGAGCCAGGCCTGGG + Intronic
1019349004 7:544450-544472 TCTGGGGCTGAGCCTGCCTAAGG + Intergenic
1019478604 7:1255809-1255831 AGCCCGGCTGAGCCGGCCCAGGG + Intergenic
1019601653 7:1886713-1886735 AGCAGAGCAGGGCCTGCCCAGGG - Intronic
1019700027 7:2470320-2470342 CCCTGGGCTGGGCCTGTCCAGGG - Intergenic
1021756639 7:23858920-23858942 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1021847607 7:24778230-24778252 ATCAGGTCTCAGCCTTCCCAGGG + Intergenic
1022103582 7:27183418-27183440 ACCTGGGCTGCCCCTTCCCAAGG + Intronic
1022581978 7:31564600-31564622 ACCAGGCTTGAGACTGCCCCAGG - Intronic
1023439246 7:40169470-40169492 AGCAGGACTGAGGGTGCCCAGGG - Intronic
1023996283 7:45161006-45161028 ACCAGCCCTGGGCCTGCACAAGG - Intronic
1024544354 7:50504793-50504815 AGCAGGGCCCAGACTGCCCAAGG + Intronic
1024914368 7:54482976-54482998 AGCAGGACTGAGCCTGCAAAGGG - Intergenic
1025082944 7:56000342-56000364 ACCAGGCATGACCTTGCCCAGGG - Intergenic
1025724543 7:64044873-64044895 ACCAAAGCTGAGCCTGCCTGAGG - Intronic
1025753557 7:64313399-64313421 ACCAAAGCTGAGCCTGCCTGAGG - Intronic
1025798378 7:64760827-64760849 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1025995050 7:66522685-66522707 GCCAGGGCAGAGCCTACCCAAGG + Intergenic
1026986695 7:74559380-74559402 GCCAGGGCAAAGCCTGCACAAGG + Intronic
1028495141 7:91453149-91453171 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1029714634 7:102319246-102319268 AGCTGGGCAGAGCCTGCGCAGGG - Intronic
1030045743 7:105493710-105493732 ACCAGGGGTGTGCGTGCACAGGG + Intronic
1031253107 7:119413448-119413470 ACCATGCCTGAGCCTCCCCCGGG - Intergenic
1031264612 7:119567587-119567609 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
1034267843 7:149789802-149789824 ACCAGGGCTGGCGCTGGCCAGGG - Intergenic
1035085627 7:156255050-156255072 ACCAGACCTCAGCCTGGCCATGG - Intergenic
1035165818 7:156989118-156989140 ACCAGGGCTGCTCCCGCCCGGGG + Intergenic
1035284828 7:157799470-157799492 ACCAGAGCAGACCCAGCCCAGGG + Intronic
1037504332 8:19515393-19515415 ACCAGCACTGACCCAGCCCAGGG + Intronic
1037571051 8:20158072-20158094 AGCAGGACTGAGGGTGCCCAGGG + Intronic
1038430696 8:27497210-27497232 AACAGGACTGAGGGTGCCCAGGG - Intronic
1038491287 8:27973649-27973671 CCAAGGCCTGAGCCTGCCCCTGG + Intronic
1039404675 8:37302304-37302326 GACAGGGCTGAGCAGGCCCAGGG - Intergenic
1040649040 8:49429509-49429531 AACAGGACTGAGGTTGCCCAGGG + Intergenic
1040746062 8:50643826-50643848 ACCAGGGCTCAGCCTCCTCTTGG - Intronic
1040953485 8:52957834-52957856 AACAGGACTGAGGGTGCCCAGGG + Intergenic
1040964974 8:53073911-53073933 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1041001993 8:53462767-53462789 AACAGGACTGAGGGTGCCCAGGG + Intergenic
1041472420 8:58225495-58225517 ACCAGGCCTGAGGCTTCTCAGGG - Intergenic
1041856453 8:62461014-62461036 TCCAGGGCTGTGCCTGCTCAGGG + Intronic
1042056172 8:64766784-64766806 AGCAGGACTGAGGGTGCCCAGGG + Intronic
1043188833 8:77190791-77190813 AGCAGGGCTGTGGCTGCCGAGGG + Intergenic
1044437110 8:92177323-92177345 ACCAGGGCAGAGTCTGCACACGG + Intergenic
1044501801 8:92966170-92966192 ACCAGGCCTCAGCCTGCTCTCGG + Intronic
1045046438 8:98283621-98283643 ACCTGGGCTGGGCCTGCAAAAGG - Intronic
1045074034 8:98542640-98542662 AGCAGGGCTGACAATGCCCAGGG + Intronic
1045858633 8:106791741-106791763 AACAGGACTGAGGGTGCCCAGGG + Intergenic
1046591027 8:116207248-116207270 ACCCAAGCTGAGGCTGCCCATGG - Intergenic
1048264121 8:132970695-132970717 ACCAGGGATCAGCCTGACCGCGG + Intronic
1048995334 8:139790537-139790559 ACCAGGGGTGGTCCTGCCCCTGG + Intronic
1049249726 8:141581882-141581904 ACCCAGGCTGAGCCTTTCCAAGG - Intergenic
1049271380 8:141698070-141698092 ACTAGGACTGAGTCTGCCAATGG + Intergenic
1049315798 8:141966726-141966748 ACGAAGCCTGAGCCTTCCCAGGG + Intergenic
1049345207 8:142135061-142135083 ATCAGGGCTCAGCATGGCCAAGG + Intergenic
1049785939 8:144450849-144450871 TCCCCGGCTGAGCCTGCCCTCGG - Intronic
1049835011 8:144729972-144729994 GGCAGGGCTGAGCCCACCCAGGG + Intronic
1050026012 9:1335222-1335244 ACCAGGACGGACCCTCCCCAAGG - Intergenic
1052851601 9:33381594-33381616 ACCAGGGCTGGGAGTGACCAGGG - Intergenic
1053122296 9:35556163-35556185 GCCATGGCAGAGCCTGCCCCGGG - Intronic
1057037070 9:91818795-91818817 GCCAGAGGTGAGGCTGCCCAAGG - Intronic
1057133379 9:92669985-92670007 GCCAGGGCTGCGCCTGGGCATGG - Exonic
1059329333 9:113525045-113525067 ACAAGGGCTGAGGATGGCCAAGG + Intronic
1059341246 9:113598705-113598727 AACAGGGCTGGCCTTGCCCAGGG - Intergenic
1059365940 9:113786551-113786573 GCCAGGCCTGAGCCAGCCCCAGG + Intergenic
1059465343 9:114465918-114465940 GCCAGGCCTGAAGCTGCCCAGGG + Intronic
1059695498 9:116726501-116726523 ACCAGGGCTTGAACTGCCCATGG + Intronic
1060090021 9:120734520-120734542 ACCAGGCCTCTGCCTTCCCAGGG + Intergenic
1060400859 9:123348881-123348903 ATCAGGGCTCAGTCAGCCCAGGG - Intergenic
1060969746 9:127731268-127731290 AGCAAGGCTGAGGGTGCCCAGGG + Exonic
1060973271 9:127751100-127751122 GCCAGGGCTGGGGCTGGCCAAGG + Intronic
1061059180 9:128242179-128242201 ACAGGGCCTGAGCCTCCCCATGG - Intronic
1061395801 9:130342754-130342776 GCCAGGGCTGAGGCAGCCCGGGG + Intronic
1061578752 9:131523950-131523972 ACGGGGGCTGGGGCTGCCCATGG + Exonic
1061798650 9:133102677-133102699 ACAGGGGCTGAGGCTGACCATGG + Intronic
1062008756 9:134256012-134256034 ACCAGCTCTGAGCCTGCCTTGGG - Intergenic
1062104510 9:134746206-134746228 TCCCGAGCTGGGCCTGCCCAGGG + Intronic
1062543513 9:137051892-137051914 ACCTGGGTTGACCATGCCCAGGG - Intronic
1203662416 Un_KI270753v1:57632-57654 ACAAGGCCTGAGCCTCCCCGAGG + Intergenic
1185504336 X:620183-620205 CCCAGGGCTGGCCCTACCCAAGG + Intergenic
1185894312 X:3844029-3844051 CCCAGGGCCGCGCCTGCCCACGG - Intergenic
1185899431 X:3882453-3882475 CCCAGGGCCGCGCCTGCCCACGG - Intergenic
1185904548 X:3920882-3920904 CCCAGGGCCGCGCCTGCCCACGG - Intergenic
1186254194 X:7701605-7701627 AGCAGGACTGAGGGTGCCCAGGG - Intergenic
1188097604 X:26043294-26043316 AACAGGACTGAGGGTGCCCAGGG + Intergenic
1189870843 X:45381419-45381441 TGCAGGGCTGAGTCTGCTCAAGG + Intergenic
1190221871 X:48517059-48517081 TCCAGGACTGAGGATGCCCAGGG - Intronic
1192142635 X:68658874-68658896 TCCAAGGCTGAGGCTGCCAAGGG + Intronic
1193171922 X:78346972-78346994 AGCAGGACTGAGGGTGCCCAGGG - Intergenic
1194668688 X:96704367-96704389 ACCAGGGGAGCCCCTGCCCAAGG - Intronic
1199832330 X:151559036-151559058 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1200231697 X:154447000-154447022 ACCTGTGCTGTGCCTGGCCAGGG + Intronic
1200800946 Y:7386710-7386732 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1200945398 Y:8830510-8830532 AACAGGACTGAGGGTGCCCAGGG + Intergenic
1201473100 Y:14354756-14354778 AACAGGACTGAGGGTGCCCAGGG - Intergenic
1201905635 Y:19083513-19083535 AGCAGGACTGAGGGTGCCCAGGG + Intergenic
1202583550 Y:26404192-26404214 ACCAGGGCTGAGTCAGGGCAGGG + Intergenic