ID: 923096699

View in Genome Browser
Species Human (GRCh38)
Location 1:230780729-230780751
Sequence CACTAAAAGAAGTGGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923096699_923096705 12 Left 923096699 1:230780729-230780751 CCAGAATCCCACTTCTTTTAGTG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 923096705 1:230780764-230780786 AGAAGTCACCTGGGAACTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 288
923096699_923096704 3 Left 923096699 1:230780729-230780751 CCAGAATCCCACTTCTTTTAGTG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 923096704 1:230780755-230780777 TATTCACACAGAAGTCACCTGGG 0: 1
1: 0
2: 0
3: 9
4: 236
923096699_923096703 2 Left 923096699 1:230780729-230780751 CCAGAATCCCACTTCTTTTAGTG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 923096703 1:230780754-230780776 TTATTCACACAGAAGTCACCTGG 0: 1
1: 0
2: 3
3: 8
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923096699 Original CRISPR CACTAAAAGAAGTGGGATTC TGG (reversed) Intronic
903176512 1:21584725-21584747 CTCTATAAGATCTGGGATTCTGG + Intergenic
903460387 1:23516709-23516731 CCCTAAAAGAAGTGGGCTTCAGG - Intronic
903752981 1:25640981-25641003 CGCTAATAGGAGCGGGATTCAGG + Intronic
904921031 1:34008378-34008400 AACTAAAAGAGTTGGGATTTGGG - Intronic
905029203 1:34870278-34870300 TACTTTAAGAAGTGGGAGTCAGG + Intronic
905798219 1:40827355-40827377 CCCTAAAAGCAGTGGGTTTCAGG + Intronic
908103324 1:60813488-60813510 TTCAAAAAGAAGGGGGATTCAGG - Intergenic
912160366 1:106975789-106975811 CACTAGAAAAAGTGAGATTGAGG + Intergenic
913272148 1:117104860-117104882 AATTAACAGAAGTGGCATTCTGG + Exonic
914473691 1:148005615-148005637 CAGTAAATGAAGTAGGAATCGGG - Intergenic
916000323 1:160608868-160608890 AAATAATAGAAGTGGGATTCAGG - Exonic
917495473 1:175536763-175536785 CACCAAAGGAAGTGGAATTAAGG + Intronic
917993454 1:180408854-180408876 CATTAAAAGAACTGGAAGTCTGG + Intronic
918142092 1:181727987-181728009 CACTCACAGAAGAGGGATCCAGG - Intronic
920780338 1:208984841-208984863 CTCTGAAAGAAGTGTGATTTGGG + Intergenic
920788001 1:209061198-209061220 CATTAAATGAAGTGGGATGGTGG + Intergenic
921311324 1:213846537-213846559 AACTAAAAGAAATTGGCTTCAGG - Intergenic
921508109 1:215999024-215999046 AAGAAAAATAAGTGGGATTCTGG - Exonic
923096699 1:230780729-230780751 CACTAAAAGAAGTGGGATTCTGG - Intronic
923649003 1:235854482-235854504 CACTAGATGAAGTGCTATTCTGG - Intronic
1067678194 10:48405412-48405434 CACTTAAAGAGGTGGGAGTGGGG - Intronic
1069546380 10:69332209-69332231 CATTTAAAGCAGTGGGTTTCTGG + Intronic
1072070832 10:91915291-91915313 CACTAAATGAATTGAGTTTCAGG - Intergenic
1075219947 10:120576232-120576254 CATTCAAAGAAGCTGGATTCAGG - Intronic
1081001581 11:37680024-37680046 CACTAGAAAAAGTGAGATTGAGG + Intergenic
1081007253 11:37760522-37760544 GTCTAAAAGAAATTGGATTCAGG - Intergenic
1082114949 11:48317496-48317518 CACTACCAGAAGTGGGATTTGGG - Intergenic
1082909610 11:58355661-58355683 CACCAAGAGAAGAGGGATTGCGG - Intergenic
1095909350 12:47410120-47410142 CATCAAAAGAAATGGTATTCTGG + Intergenic
1097567269 12:61286849-61286871 AACTAAAAGAAGTGGGAGATAGG + Intergenic
1098046472 12:66406415-66406437 CACTAACAGAACTGGGACCCTGG - Exonic
1098187065 12:67908449-67908471 CCTTAAAAGAAGGGGCATTCTGG - Intergenic
1100532768 12:95475481-95475503 CACGAAATGAAGTGACATTCTGG - Intronic
1101650031 12:106669007-106669029 GACTTAAATAAGTGGGATTGAGG - Intronic
1101853859 12:108425884-108425906 CACAAAAAGAAGTGGGAAGTGGG + Intergenic
1102131560 12:110534061-110534083 AACTAAAAGAAATGGGATGCAGG - Exonic
1102501210 12:113353806-113353828 CACTAAAAGGAATGGGGGTCTGG - Intronic
1102657118 12:114491379-114491401 CACTGCAAAAAGTGGGAGTCAGG + Intergenic
1102848956 12:116220355-116220377 GTCTAAGAGAAGTGGGAATCTGG - Intronic
1103124042 12:118405964-118405986 CAGCAAAACAAATGGGATTCAGG + Intronic
1103898349 12:124289471-124289493 CACTGAAAGCACTGGGAATCTGG + Intronic
1103917256 12:124382297-124382319 CACTACAGGAAGTGGGGCTCAGG - Intronic
1107431677 13:40345987-40346009 CACTACAAGGAGTCAGATTCAGG + Intergenic
1107462044 13:40613638-40613660 CACTAAACCAAGTGAGAGTCAGG - Intronic
1108692796 13:52874724-52874746 CACTAAAAGAAATGCCATGCCGG - Intergenic
1109970987 13:69769232-69769254 GACTAAAAGAAGGGTGAGTCTGG + Intronic
1110184104 13:72653683-72653705 CACTAAAAAGGGTGGGATTTTGG - Intergenic
1110670586 13:78172613-78172635 TACAAAAAGTAGTGGGATTAAGG + Intergenic
1114860304 14:26510115-26510137 CACTGAAAGAAGAGGAATACAGG + Intronic
1116764884 14:49058252-49058274 CAACAAAAGAAGTGAGATTCAGG + Intergenic
1117512014 14:56461859-56461881 CTCTAAAAGAGGCGGCATTCTGG + Intergenic
1124169544 15:27360442-27360464 CACTCAGAGAAGTGTGTTTCTGG - Intronic
1125189830 15:36977889-36977911 CAGTAAATGGAGTGGAATTCAGG - Intronic
1128516724 15:68346775-68346797 CACTAAAAGAAGGGGTGGTCAGG - Intronic
1131013161 15:89035584-89035606 CACTAAAAGAAATGGGCTTTGGG - Intergenic
1137435649 16:48452545-48452567 AAATAAAAGAACTGGGATTTTGG - Intergenic
1139198705 16:64950624-64950646 CAAGAAAAGAAGTGGGGTACGGG - Intronic
1140170148 16:72596095-72596117 GACTTAAAGAAGTAGGATTTTGG - Intergenic
1140828400 16:78728473-78728495 CAGGAAAAGAAGTGAGAATCTGG - Intronic
1140858145 16:78996027-78996049 CACTGAAAGAAGAGGGAAACTGG + Intronic
1141387143 16:83632205-83632227 CAGAAACAGAACTGGGATTCAGG - Intronic
1142611699 17:1111959-1111981 CACTAACAGAAGTGGAAACCCGG - Intronic
1143245765 17:5484677-5484699 CACTAACAGAATTGAGTTTCTGG + Intronic
1143268589 17:5659014-5659036 CACGGACAGAAGTGGGAGTCAGG + Intergenic
1144564935 17:16352617-16352639 CACAAAAAAAAAGGGGATTCGGG + Intronic
1153590170 18:6665346-6665368 CACTAAGAGAAAGGGGATTTGGG - Intergenic
1153778479 18:8474204-8474226 CACCTAAAGAGGTGGGATTTAGG - Intergenic
1155214076 18:23627305-23627327 CCCTAAAAGAATTGTTATTCAGG - Intronic
1160889187 19:1368409-1368431 CACTGAATCAAGTGGGCTTCGGG - Intronic
1160938106 19:1606965-1606987 AACTTAAAAAAGTGGGATGCAGG + Intergenic
1161651040 19:5485111-5485133 CACTAAGAAAAGGGGGCTTCTGG + Intergenic
928708561 2:33978814-33978836 CACTAGAATAAGTGAGATTTGGG + Intergenic
931010569 2:57907684-57907706 CAATCAGAGAAGTAGGATTCTGG - Exonic
931232510 2:60386797-60386819 AAATAAAAGAAAGGGGATTCTGG + Intergenic
933111328 2:78405072-78405094 CACTAATAGTTGTGGAATTCTGG - Intergenic
936493278 2:112994457-112994479 CACTAGGAGAAGGGGGATTCTGG + Intergenic
936674742 2:114701988-114702010 CACTAGAGGAAGGGGGATTTGGG + Intronic
937535896 2:122886632-122886654 CACTAAGAAAAGGGGGATTTTGG + Intergenic
940040630 2:149356520-149356542 CATTAAAAGAAATGGCACTCAGG - Intronic
940174898 2:150867831-150867853 GACAAAAAGAAGTGCAATTCAGG + Intergenic
941721107 2:168814045-168814067 CACTAAAAGAGATGGCATTTGGG + Intronic
943102507 2:183505392-183505414 CACTGAAAAAAGTGAGATTGAGG - Intergenic
944325368 2:198398045-198398067 CAGTTAAAGAAGTGGGTTTTAGG + Intronic
945008808 2:205439831-205439853 CACTAAAAGCAGTGGGATCAGGG - Intronic
948219618 2:236259391-236259413 CCCTAGAAGAGGTGGCATTCAGG + Intronic
1169506618 20:6218542-6218564 CAGTAAATAAAGTGGGAATCAGG + Intergenic
1169893250 20:10475557-10475579 CTCTTTGAGAAGTGGGATTCTGG + Intronic
1170232150 20:14061223-14061245 CACTGAAATAAGTTGGATGCTGG + Intronic
1172954978 20:38749734-38749756 CATTAGAAGCAGTTGGATTCTGG + Intronic
1177298946 21:19215023-19215045 AAGTAAAAGAAATGGGATTAAGG - Intergenic
1178361693 21:31953821-31953843 CTCCAAAAGAAATGGAATTCTGG + Intronic
1178678272 21:34649360-34649382 CAATAAATGAAGAGGGATTTGGG + Intergenic
1181526356 22:23490943-23490965 CTCTCAAAGAGCTGGGATTCAGG + Intergenic
1184906468 22:47490128-47490150 CACTTAGAAAAGTGGGACTCCGG + Intergenic
955156807 3:56425099-56425121 CTCTAAAGGAAGTGGGATGAAGG - Intronic
955997683 3:64694146-64694168 CATTCACAGATGTGGGATTCTGG + Intergenic
957458271 3:80481654-80481676 GAATAAAAGAAGTGGAATTGGGG - Intergenic
959370112 3:105513329-105513351 CACTAAAAGCACTGGGCTTTAGG - Intronic
960029391 3:113042105-113042127 CACTAAAGGAAGTGGGATGATGG - Intergenic
960511741 3:118557337-118557359 AACTGAAAAAAGTGGGCTTCAGG - Intergenic
964465927 3:156992351-156992373 GACTAAAAGCAGGGAGATTCTGG - Intronic
968072833 3:195797846-195797868 CTCTCAAAGCACTGGGATTCAGG - Intronic
971204975 4:24556966-24556988 TAATAAAAGAAGTGGGACTGAGG + Intronic
971630694 4:28989061-28989083 CATTAAAAGAAGTGAGATCACGG - Intergenic
976028932 4:80727204-80727226 CACTAAATGACCTGGAATTCTGG - Intronic
977125416 4:93160458-93160480 CACTCAAAGAAATTGGATTTGGG - Intronic
977408136 4:96626576-96626598 CACTAAAATGAGTAGGAATCAGG + Intergenic
977739717 4:100463939-100463961 CTTTAAAAGAACTGGGATTCTGG + Intronic
979313377 4:119230626-119230648 CCAGAAAAGAAGTTGGATTCAGG + Intronic
982667201 4:158279570-158279592 CACTATAAGAAGAGGTATGCAGG - Intergenic
984289172 4:177771310-177771332 CCCTAAATAAAGTGGGAATCAGG - Intronic
984551636 4:181167005-181167027 AAATAAAAGAAGTGGGATACGGG - Intergenic
986736518 5:10672225-10672247 GACTAACACAAGTGGGTTTCTGG + Intergenic
991578364 5:68128206-68128228 ACCTTAAAGAAGTGGGATACAGG - Intergenic
992166186 5:74054227-74054249 CATTAAAAGAAATGAGATTATGG + Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
996024576 5:118630551-118630573 CACAAAAATAAGAGTGATTCTGG - Intergenic
998829910 5:146146416-146146438 CATTTAAAGAAGTGGGTATCTGG + Intronic
999029267 5:148272439-148272461 TACTAAAACAATTGGGCTTCTGG - Intronic
1002698809 5:181108462-181108484 CATAAATACAAGTGGGATTCAGG + Intergenic
1002946755 6:1769196-1769218 CACTAATAGAACTGGGTTTACGG + Intronic
1007019083 6:38501241-38501263 CACTCAAAAAAGTCAGATTCTGG - Intronic
1007652914 6:43434233-43434255 AACCAAAAGATGTGGGCTTCGGG - Intronic
1009152216 6:59763182-59763204 TACTACAAGAAGTGTGTTTCAGG - Intergenic
1009609196 6:65917111-65917133 CACTAAAAAAAGTTGAATTGGGG + Intergenic
1011788766 6:90875514-90875536 GACCAAAAAAAGGGGGATTCAGG + Intergenic
1012110774 6:95229493-95229515 CTCTAAAAGAAATAGGATTTGGG + Intergenic
1016641583 6:146355508-146355530 CCCTAAAAGAAAAGGTATTCTGG - Intronic
1016856952 6:148680116-148680138 CAATAAAATAACTGGGCTTCAGG - Intergenic
1019762752 7:2825726-2825748 CACTGAAAGAAGGAGGATGCAGG + Intronic
1020562266 7:9743828-9743850 CTCTAAAATAAATGGAATTCAGG - Intergenic
1023689923 7:42775026-42775048 CACTAAAGGAAGAGGGGGTCAGG + Intergenic
1024321972 7:48079661-48079683 CTCTAGAAGAACTGGGGTTCAGG + Intergenic
1024717723 7:52099968-52099990 CAATAAGAAAAGTGGGACTCTGG - Intergenic
1025118994 7:56283740-56283762 CACTCAAAGTAGTGAAATTCTGG + Intergenic
1027331675 7:77102699-77102721 CACCAAAAGAAATGTGATTATGG + Intergenic
1028152185 7:87386967-87386989 CACTGAAAGAAGTGAGATCAAGG - Intronic
1029784095 7:102768636-102768658 CACCAAAAGAAATGTGATTATGG - Intronic
1030742377 7:113125215-113125237 AACCAAAAGAGGTAGGATTCTGG - Intergenic
1031763688 7:125747204-125747226 CACTTAAAGAAATGAGAATCGGG + Intergenic
1031868850 7:127070138-127070160 CACTAAAATAAGTGGATATCTGG + Intronic
1032418634 7:131759388-131759410 CAGAAAAAAATGTGGGATTCAGG - Intergenic
1032575197 7:133046060-133046082 CACTAAAAAAAGTAAGATTCAGG - Intronic
1033055216 7:138046471-138046493 CACTAGAAAAAGTGAGATTGAGG + Intronic
1036699633 8:11003677-11003699 AACTGTAAGAACTGGGATTCTGG + Intronic
1038380751 8:27091012-27091034 CTCTAAAAGATGTAGCATTCAGG - Intergenic
1045807692 8:106184347-106184369 AACTAACAGAAATAGGATTCAGG + Intergenic
1046474248 8:114719990-114720012 CACTAAAAGATGTGGGTTATTGG - Intergenic
1046876487 8:119260276-119260298 CAGTAAAAAAAGTAGGAATCAGG - Intergenic
1047676129 8:127205316-127205338 CACAAAGTAAAGTGGGATTCAGG - Intergenic
1049446208 8:142632688-142632710 CACTCAGAGAAGAGGGATCCTGG - Intergenic
1050487417 9:6148773-6148795 CATTAAAACAAGTGGGGGTCAGG + Intergenic
1051100258 9:13513211-13513233 CACTAAAAGACTGGGAATTCAGG + Intergenic
1051821004 9:21168296-21168318 TGCTAAAACCAGTGGGATTCTGG + Intergenic
1057883431 9:98809767-98809789 CAATAAAGGAAGTTGGATCCAGG - Intronic
1058998810 9:110326767-110326789 GATTAAAACAATTGGGATTCTGG - Intronic
1062564658 9:137158803-137158825 CACTAAAGGAAGTGGGGGTGGGG + Intronic
1186447983 X:9648122-9648144 CAGGTAAAGATGTGGGATTCAGG - Intronic
1190322820 X:49188460-49188482 CAAGGCAAGAAGTGGGATTCAGG - Exonic
1191996165 X:67097392-67097414 CCCTAGAAGCAGTGGAATTCTGG + Intergenic
1198179090 X:134187280-134187302 AACAATAAGAAGTGGGATTTGGG - Intergenic
1201584288 Y:15543753-15543775 AAATAAAAGAATTGGGATGCGGG + Intergenic