ID: 923097297 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:230785588-230785610 |
| Sequence | CAATTATTGCAGAAGGTGAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9959 | |||
| Summary | {0: 4, 1: 107, 2: 1520, 3: 2780, 4: 5548} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 923097297_923097302 | 11 | Left | 923097297 | 1:230785588-230785610 | CCCTTCACCTTCTGCAATAATTG | 0: 4 1: 107 2: 1520 3: 2780 4: 5548 |
||
| Right | 923097302 | 1:230785622-230785644 | AGGCCTCCTTAGAAGCAGAACGG | 0: 1 1: 0 2: 1 3: 18 4: 199 |
||||
| 923097297_923097300 | -9 | Left | 923097297 | 1:230785588-230785610 | CCCTTCACCTTCTGCAATAATTG | 0: 4 1: 107 2: 1520 3: 2780 4: 5548 |
||
| Right | 923097300 | 1:230785602-230785624 | CAATAATTGTAAGTTTCCTGAGG | 0: 7 1: 603 2: 6974 3: 8695 4: 6576 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 923097297 | Original CRISPR | CAATTATTGCAGAAGGTGAA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||