ID: 923097297

View in Genome Browser
Species Human (GRCh38)
Location 1:230785588-230785610
Sequence CAATTATTGCAGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9959
Summary {0: 4, 1: 107, 2: 1520, 3: 2780, 4: 5548}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923097297_923097302 11 Left 923097297 1:230785588-230785610 CCCTTCACCTTCTGCAATAATTG 0: 4
1: 107
2: 1520
3: 2780
4: 5548
Right 923097302 1:230785622-230785644 AGGCCTCCTTAGAAGCAGAACGG 0: 1
1: 0
2: 1
3: 18
4: 199
923097297_923097300 -9 Left 923097297 1:230785588-230785610 CCCTTCACCTTCTGCAATAATTG 0: 4
1: 107
2: 1520
3: 2780
4: 5548
Right 923097300 1:230785602-230785624 CAATAATTGTAAGTTTCCTGAGG 0: 7
1: 603
2: 6974
3: 8695
4: 6576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923097297 Original CRISPR CAATTATTGCAGAAGGTGAA GGG (reversed) Intronic
Too many off-targets to display for this crispr