ID: 923102278

View in Genome Browser
Species Human (GRCh38)
Location 1:230826192-230826214
Sequence CTCCAGGTGCATTCTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923102278_923102281 3 Left 923102278 1:230826192-230826214 CCAGGCACAGAATGCACCTGGAG No data
Right 923102281 1:230826218-230826240 GAGCTGAGTAGAACGAGAGCTGG No data
923102278_923102282 6 Left 923102278 1:230826192-230826214 CCAGGCACAGAATGCACCTGGAG No data
Right 923102282 1:230826221-230826243 CTGAGTAGAACGAGAGCTGGAGG No data
923102278_923102287 27 Left 923102278 1:230826192-230826214 CCAGGCACAGAATGCACCTGGAG No data
Right 923102287 1:230826242-230826264 GGGTGGGAGCTGCGTGTTGGAGG No data
923102278_923102285 11 Left 923102278 1:230826192-230826214 CCAGGCACAGAATGCACCTGGAG No data
Right 923102285 1:230826226-230826248 TAGAACGAGAGCTGGAGGGTGGG No data
923102278_923102286 24 Left 923102278 1:230826192-230826214 CCAGGCACAGAATGCACCTGGAG No data
Right 923102286 1:230826239-230826261 GGAGGGTGGGAGCTGCGTGTTGG No data
923102278_923102288 28 Left 923102278 1:230826192-230826214 CCAGGCACAGAATGCACCTGGAG No data
Right 923102288 1:230826243-230826265 GGTGGGAGCTGCGTGTTGGAGGG No data
923102278_923102283 7 Left 923102278 1:230826192-230826214 CCAGGCACAGAATGCACCTGGAG No data
Right 923102283 1:230826222-230826244 TGAGTAGAACGAGAGCTGGAGGG No data
923102278_923102284 10 Left 923102278 1:230826192-230826214 CCAGGCACAGAATGCACCTGGAG No data
Right 923102284 1:230826225-230826247 GTAGAACGAGAGCTGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923102278 Original CRISPR CTCCAGGTGCATTCTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr