ID: 923104127

View in Genome Browser
Species Human (GRCh38)
Location 1:230841353-230841375
Sequence GCACGTGCAGCCATCTGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923104124_923104127 -6 Left 923104124 1:230841336-230841358 CCCTCCTCGGGAGGACAGCACGT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 923104127 1:230841353-230841375 GCACGTGCAGCCATCTGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
923104126_923104127 -10 Left 923104126 1:230841340-230841362 CCTCGGGAGGACAGCACGTGCAG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 923104127 1:230841353-230841375 GCACGTGCAGCCATCTGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
923104120_923104127 6 Left 923104120 1:230841324-230841346 CCGCTGGATCCTCCCTCCTCGGG 0: 1
1: 0
2: 9
3: 93
4: 3095
Right 923104127 1:230841353-230841375 GCACGTGCAGCCATCTGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
923104125_923104127 -7 Left 923104125 1:230841337-230841359 CCTCCTCGGGAGGACAGCACGTG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 923104127 1:230841353-230841375 GCACGTGCAGCCATCTGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
923104123_923104127 -3 Left 923104123 1:230841333-230841355 CCTCCCTCCTCGGGAGGACAGCA 0: 1
1: 0
2: 1
3: 15
4: 185
Right 923104127 1:230841353-230841375 GCACGTGCAGCCATCTGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923104127 Original CRISPR GCACGTGCAGCCATCTGCCG AGG Intronic
900707452 1:4089549-4089571 GCAAGTGCAGCCTGCTGCCCTGG - Intergenic
900722536 1:4186685-4186707 GCACTTGCAGCCAGCTCCTGGGG + Intergenic
901631163 1:10648882-10648904 ACACATGCAGCCCTCAGCCGGGG - Intronic
902211001 1:14904536-14904558 GTGCGTGCAGACATCTGCAGTGG - Intronic
904689655 1:32284168-32284190 GCACCTGAGGCCATCTGCGGTGG - Intronic
920300615 1:204986421-204986443 GGACGTGCTGCCTTCTGCCTCGG - Intronic
923104127 1:230841353-230841375 GCACGTGCAGCCATCTGCCGAGG + Intronic
1063750152 10:8934808-8934830 GGACATGCAGCCACCTGCCCAGG - Intergenic
1064918237 10:20486430-20486452 CCACATGCAGCCATGGGCCGCGG - Intergenic
1069930605 10:71878994-71879016 CCAGGTGCAGCCATGTGCGGTGG - Intergenic
1076776774 10:132702031-132702053 GCACCTGCAGCCACGGGCCGTGG + Intronic
1077390018 11:2296532-2296554 GGACCTGCAGCCATTTGCTGGGG - Intronic
1078035987 11:7805942-7805964 GAATGTGCAGCCCTCTGCAGGGG - Intergenic
1080867510 11:36208365-36208387 GCAGGTTCAGCCATCTAGCGAGG + Intronic
1080992848 11:37560586-37560608 GGACCTGCAGCCATCCGCTGAGG - Intergenic
1082739326 11:56893077-56893099 GCAGGTGCAGCCATGGGCCTGGG - Intergenic
1086318538 11:85619544-85619566 ACATGTGCAGCCATATGCAGTGG + Intronic
1093110479 12:15145582-15145604 GCACGTGCTGCAATCTGACAAGG + Intronic
1096145798 12:49277726-49277748 GCTCCTGGAGCCATCTGCCTGGG - Intergenic
1101279829 12:103241407-103241429 GCAGGTGCAGCCACCGGACGTGG - Intronic
1102967808 12:117141500-117141522 GCTGCTGCAGCCATCTGCGGTGG + Intergenic
1106135788 13:26972407-26972429 GCAGGTGAGGCCATCTGCGGAGG + Intergenic
1110661883 13:78066512-78066534 GCAGGTGCAGCAAGCGGCCGTGG - Intergenic
1119029811 14:71183201-71183223 GCTCATTCAGCCATCTGCCTGGG - Intergenic
1121637069 14:95461199-95461221 GCTCGTGCAGCCCTTTGCAGAGG - Intronic
1129359248 15:75014148-75014170 GCACATGCAAGCATCTGCCCAGG - Intronic
1129843478 15:78757644-78757666 GCACCTGCAGGCAGCTGCCGTGG + Intergenic
1142238448 16:88934236-88934258 GCCCGTGCCTCCATGTGCCGAGG - Intronic
1142485979 17:247950-247972 TCCCGTGCAGCCCTCTGCCTTGG - Intronic
1152214962 17:79026746-79026768 GCAGGTGCAGCCAGCTGGCGAGG + Intronic
1155209206 18:23586473-23586495 GCGCGCGCAGCCTGCTGCCGCGG - Exonic
1157612117 18:48963639-48963661 GCACGCACAGCCAACTGTCGGGG - Intergenic
1158387967 18:57016076-57016098 CCACGTGCAGCCAACTGGGGAGG + Intronic
1160663272 19:311380-311402 GCAGGTGCTGCCAAGTGCCGGGG - Intronic
1160911559 19:1476233-1476255 GCACGTGGAGCCTTCGTCCGTGG - Intronic
1161221510 19:3120214-3120236 GCGCCTGCAGCCAGCGGCCGAGG - Intronic
927731077 2:25472369-25472391 GCATATGCAGCCACCTGCCTGGG + Intronic
931493661 2:62778247-62778269 CCAGGTCCAGCCATCTGCCTTGG - Intronic
937347246 2:121133629-121133651 GGAGATGCAGCCATCTGCCACGG + Intergenic
944394143 2:199249185-199249207 GCACGTGTAGCCAGCTCCTGGGG - Intergenic
948852151 2:240713693-240713715 GCACCTACAGCCATTTTCCGGGG + Intergenic
1173845980 20:46189089-46189111 GCAGGTGCAGCCACCTCCTGGGG + Intronic
1174284133 20:49460282-49460304 GCACATGCTGCCATCTGACTAGG - Intronic
1175292167 20:57883000-57883022 CCACGTGCAACCATCAGCCCAGG + Intergenic
1175840801 20:62025915-62025937 GCACGTGGAGCCATCACCCCAGG - Intronic
1176051797 20:63123712-63123734 GCCCGTGCCGCCATCTACCCGGG - Intergenic
1179126963 21:38599237-38599259 GCAAGTCCAGCCACCTGCCATGG - Intronic
1179507614 21:41852321-41852343 ACACGTGCTGCCAGCTGCCTAGG + Intronic
1179642514 21:42756816-42756838 GCACGTGCAGTCCTCAGCCCCGG - Intronic
1183535547 22:38398665-38398687 AGGGGTGCAGCCATCTGCCGAGG + Intergenic
1185388991 22:50548823-50548845 GCACGTCCAGGCAACTGCCCAGG - Exonic
950311050 3:11958249-11958271 GCACGTGGAGACAGCTGCCCTGG - Intergenic
953800355 3:46018178-46018200 GCACATCCAGCCATCTCCCTGGG - Exonic
954982624 3:54760304-54760326 GCACTTGCTGCCCTCTGCCTGGG - Intronic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
956690703 3:71875566-71875588 GCAGCTGCTGCCATCTGCTGGGG - Intergenic
961709114 3:128813397-128813419 GCAACTGCAGCTTTCTGCCGAGG - Exonic
964626143 3:158761980-158762002 GCATGTGCAGAACTCTGCCGTGG + Intronic
967036179 3:185649715-185649737 CAAAGTGCAGCCATCTGACGTGG - Intronic
991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG + Intergenic
995933981 5:117486236-117486258 TCACGTGCAACTATCTGCAGGGG - Intergenic
998947929 5:147361026-147361048 GCACTTGCAGCCATCTGTTGGGG - Intronic
1000234204 5:159342478-159342500 GCCTGTGCAGCCATGTGCCTCGG - Intergenic
1002939487 6:1703626-1703648 GCGCCTGCTGGCATCTGCCGAGG + Intronic
1011746621 6:90413141-90413163 GCATGGGCATCCATCTGCGGGGG + Intergenic
1019483076 7:1275185-1275207 CAACGGGCAGGCATCTGCCGGGG - Intergenic
1021746508 7:23746010-23746032 GTACTTGCAGCCAGCTGCAGTGG + Intronic
1024210521 7:47199407-47199429 GCAGGTTCAGCCTTCTGGCGAGG + Intergenic
1034549029 7:151808762-151808784 GGCCGCGCAGCCATCTGTCGTGG - Intronic
1034863393 7:154619461-154619483 GCAGGTGAAGCCATCTTCAGTGG - Intronic
1035714604 8:1744372-1744394 GCACGTGCTGCCATCCTTCGCGG - Intergenic
1038916613 8:32031406-32031428 TCACGTGCAGCGAGCTGCAGGGG - Intronic
1040389017 8:46933731-46933753 GCAAGGGCAGCCAGCTGCCAGGG - Intergenic
1049285983 8:141775491-141775513 GCACATGCAGGCATTTGCCTGGG - Intergenic
1050757242 9:9020571-9020593 GCACGTGCTGCCATTTTCTGAGG + Intronic
1053017562 9:34671429-34671451 GCAGATGAAGCCATCTGCCCTGG - Intergenic
1053532914 9:38899440-38899462 GCACGTGCATCCCTCTGCCCTGG + Intergenic
1054205141 9:62123869-62123891 GCACGTGCATCCCTCTGCCCTGG + Intergenic
1054633219 9:67464501-67464523 GCATGTGCATCCCTCTGCCCTGG - Intergenic
1057412506 9:94829580-94829602 GCAGCTGCAGCCAGCTGCTGAGG - Intronic
1062644183 9:137538335-137538357 GCACCTGTGCCCATCTGCCGGGG + Intronic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic